Animals and experimental procedures
PI3Kγ knockout mice (PI3Kγ-/-) [16] and mice carrying a targeted mutation in the PI3Kγ gene causing loss of lipid kinase activity (PI3KγKD/KD) [17] were on the C57BL/6J background for >10 generations. Age-matched C57BL/6 mice were used as controls. The animals were maintained at 12 h light and dark cycles with free access to food and water. The animal procedures were performed according to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. Experiments were approved by the committee of the Thuringian State Government on Animal Research.
In order to ensure appropriate acclimatization, animal were introduced at least one week before starting the interventions [18]. Animals were divided into a cohort kept at neutral ambient temperature (30±0.5°C) [19] or another cohort kept at lowered ambient temperature (26±0.5°C) during the whole experimental period for appropriate acclimatization. Then, mice received LPS (10 mg/kg, intraperitoneal, from Escherichia coli serotype 055:B5, Sigma–Aldrich, St. Louis, USA, Lot #032M4082V) as a single intraperitoneal injection. Additionally, 500 µl saline was injected subcutaneously immediately after LPS administration as well as after 24h. Clinical status was assessed at baseline and 24 h after LPS administration according to [20].
As an in vitro correlate of hypothermia and neuroinflammation, primary microglia obtained from wild type, PI3Kγ-/- and PI3KγKD/KD were exposed to an incubation temperature (TInc) of 33°C and LPS (100 ng/ml). (For overview, please refer to Tab.1.)
Telemetric assessment of body core temperature (TC) and heart rate
TC and heart rate were assessed by telemetric monitoring of electrocardiography (ECG) and abdominal temperature.
Surgical procedure: Mice were anesthetized with 2.5 % isoflurane in oxygen. A midline incision was made on the abdomen and the intraperitoneal cavity was gently opened. An implantable 1.6-g wireless radiofrequency transmitter (ETA-F10, Data Sciences International, St. Paul, MN) was inserted; the leads were transferred though the abdominal wall and the incision was closed by a surgical suture. The cathodal lead was looped forward subcutaneously to an area overlying the scapula and anchored in place with a permanent suture. The anodal lead was brought subcutaneously to rest near the heart apex. Thereafter, skin incision was sutured. A warming light was used to maintain body temperature between 36 and 37°C. Meloxicam was given for pain on the day of surgery and the following day. Experiments were initiated 10 days after recovery from surgical instrumentation. Animals were monitored continuously by telemetry by ECG as well as body temperature and motor activity recording.
Data acquisition and processing: For simultaneous ECG and body temperature, analog signals were digitalized by the telemetric receiver (model RPC-1, Data Sciences International, St. Paul, MN) and transferred via DSI Data Exchange Matrix at a sampling rate of 2 kHz with 12-bit precision (acquisition software: Ponemah Software 5.20) without a signal filter, and stored on PC for off-line data analysis. Instantaneous heart rate (HR) was derived from the reciprocal RR interval time series. Therefore, the individual R-waves, with the R-wave peak as the trigger point, were sequentially recognized (ATISApro®, GJB Datentechnik GmbH, Langewiesen, Germany). Accurate R-wave peak detection was verified by visual inspection. Temperature was continuously measured by the implanted transmitter and stored in parallel to the ECG signal.
Measurement of blood-brain barrier permeability
BBB disruption was analyzed by measurement of Evans blue (EB) extravasation into brain tissue as described previously [5, 21]. In brief, EB (4 ml/kg of a 2 % solution in PBS) was injected through the tail vein 1 h prior to killing. Deeply anaesthetized animals were transcardially perfused with ice-cold PBS (40 ml) 24 h after LPS administration. The brains were removed after blood removal, snap-frozen in liquid nitrogen and stored at -80°C. One hemisphere was homogenized in trichloroacetic acid (50 %) and centrifuged (10,000 rpm, 20 min, 4 °C). Supernatant was diluted in three volumes of ethanol. EB was quantified by fluorescence measurement (Tecan Infinite F200, excitation 620 nm, emission 670 nm) and compared to a standard curve. EB concentrations are presented as µg of EB per µl of brain tissue supernatant.
Blood and brain tissue cytokine assessment
The cytokines levels (TNF-α, IL-6, MCP-1, IL-10) in blood and brain tissues were determined using BD™ CBA Mouse Inflammation Kit (Dickinson and Company, San Jose, USA). Blood was obtained via direct heart puncture, collected in a heparinized syringe and immediately centrifuged at 1500×g for 10 min at 4°C. The plasma supernatant was taken immediately and kept at − 80 °C until measurement. The brain tissue was harvested after rinsing with cold PBS, immediately put in liquid nitrogen and kept at -80°C until processing. The brain tissue was then powdered, ice-cold diluted in PBS, homogenated and centrifuged at 1000 g for 10 min at 4°C. Supernatant was immediately kept at -80°C until measurement.
Primary microglial cells
The microglial cells were isolated from neonatal mouse cerebral cortex (6-10 brains per measure) as described [22]. The cells were co-cultivated with astrocytes for 14 days at 37°C and 5% CO2 in DMEM high glucose containing 10% FCS, 100 units/ml penicillin, 100 mg/ml streptomycin and 2.5 mg/ml amphotericin B. After 14 days, adherent microglia were separated from astrocytes by adding PBS/EDTA and careful shaking. Purity of isolated microglia was more than 95%. Purity of microglia was in the range between 95 and 98%, as confirmed by Iba1 staining (data not shown). After harvesting, microglial cells were seeded in well plates.
RNA Extraction and cDNA Synthesis
For quantification of mRNA, cells were seeded into 6-well plates and incubated at 37°C (5% CO2) overnight. Afterwards, cells were disintegrated in Trizol reagent (QIAzol Lysis Reagent (#79306), Qiagen, Hilden, Germany), Germany). Total RNA was extracted from Trizol as recommended by the manufacturer. To prevent contamination of mRNA preparation with chromosomal DNA, mRNA samples were treated with DNase. RNA amount and purity were determined by Nano- DropTM 1000 (Peqlab, Erlangen, Germany). For first strand cDNA synthesis, 1µg total RNA was employed using the RevertAid First Strand cDNA Synthesis kit (#K1612) from Thermo Fisher Scientific (Waltham, MA, USA). Synthesis followed the protocol recommended by the manufacturer.
Quantitative PCR
Quantitative PCR (qPCR) was performed with Maxima SYBR Green/ ROX qPCR Master Mix Kit (Fermentas; St. Leon Rot, Germany) containing Maxima Hot Start Taq DNA polymerase and appropriate primer pairs. The following primer pairs were used: MMP-2 forward: TGGCAGTGCAATACCTGAAC and MMP-2 reverse: CCGTACTTGCCATCCTTCTC, MMP-3 forward: GTACCAACCTATTCCTGGTTGC and MMP-3 reverse: CCAGAGAGTTAGATTTGGTGGG, MMP-9 forward: ACCACTAAAGGTCGCTCGGATGGTT, MMP-9 reverse: AGTACTGCTTGCCCAGGAAGACGAA, MMP-13 forward: GGGCTCTGAATGGTTATGACATTC, MMP-13 reverse: AGCGCTCAGTCTCTTCACCTCTT, as well as GAPDH forward: CATGGCCTTCCGTGTTTCCTA and GAPDH reverse: CCTGCTTCACCACCTTCTTGAT. Relative mRNA expression was calculated in relation to mRNA levels of the housekeeping gene, GAPDH, according to 2-ΔΔCT method [23].
In Vitro Chemotaxis Assay
To investigate the influence of lipid kinase dependent and -independent functions of PI3Kγ on microglial migration, transwell assays were performed. Cells were seeded in 6-well plates. After attachment, cells were starved and incubated with intended substances. Following stimulation, 1 Í 105 cells were transferred in 300 µl serum–free medium into the upper chamber of a 12-well chemotaxis insert (ThinCertTM, 8µm pores; Greiner-Bio-One GmbH, Frickenhausen, Germany). The chamber was placed in 700 µl serum–free medium containing chemoattractant (C5a; 10 ng/ml) and incubated at 37°C (normal TInc) or at 33°C (reduced TInc) with 5% CO2 for 2 h. Afterwards, cells on the lower side of the insert membrane were fixed with 100% ice-cold methanol and stained with 0.5% crystal violet solution (in 25% methanol) for 10 min. Average count of migrated cells was estimated through consideration of five independent visual fields.
In Vivo Microglial Migration Assay
Experiments were performed on adult (10–14 weeks) wild type, PI3Kγ-/-, and PI3KγKD/KD mice (7 mice per group) kept during the whole experimental period at neutral Ta or reduced Ta, respectively. To investigate the effect of targeted PI3Kγ mutation on microglial migration at neutral or reduced Ta, an in vivo wound healing experiment was performed. Mice were anesthetized by intraperitoneal injection of ketamine (100 mg/kg) and xylazine (16 mg/kg), and positioned in a stereotaxic apparatus (Stoelting, Wood Dale, IL, USA). Mice were then placed on a homeothermic heat blanket to maintain normal body temperature during surgery. The skull was exposed by a skin incision, and small burr holes were drilled through the skull. Using a micromanipulator focal stab, an injury was performed by gentle insertion of stainless steel pin (diameter 0.25 mm) into the parietal cortex at 3 mm below the dura mater [24, 25]. The pin was kept in place for two minutes and then removed. The burr holes were covered with bone wax, and the animals were returned to their cages. 12 h later, mice were deeply anesthetized and perfused with 4% paraformaldehyde (PFA) in phosphate buffer by cardiac puncture via the left ventricle. Brains were removed immediately after fixation and post-fixed for 5 h in 4% PFA at 4°C. After cryoprotection in phosphate-buffered saline (PBS) containing 30% sucrose, brains were frozen in methylbutane at -30°C and stored at -80°C. Whole brains were cut by horizontal sections at 40 µm on a freezing microtome (Microm International GmbH, ThermoScientific, Germany). The slices were immunostained with anti-Iba1 antibody to visualize microglia. Sections were photographed with a digital fluorescence camera (Nikon DSQi2) and mounted on the Nikon inverted research microscope Eclipse Ti (Nikon Instruments Europe B.V., Amstelveen, The Netherlands). Quantitative measurements (ImageJ software, National Institutes of Health, Bethesda, MD) blinded to the treatment groups were used to count cell numbers per voxel and expressed in mm3. At the injured region, three voxels were predefined as follows: Voxel 1, a cylinder with a diameter of 400 µm, center lying in the middle of injury, and an altitude of 40 µm; Voxel 2, hollow cylinder, subsequently on Voxel 1, with an inner diameter of 400 µm, an outer diameter of 800 µm, and an altitude of 40 µm; Voxel 3, hollow cylinder, subsequently on Voxel 2, with an inner diameter of 800 µm, an outer diameter of 1200 µm, and an altitude of 40 µm. Number of Iba1-positive cells was counted in all three voxels. Migratory index was estimated as the ratio of cell number in Voxel 1 divided by the sum of cell number in Voxels 1, 2 and 3 as described previously [24, 26].
In Vitro Phagocytosis Assay
Efficiency of phagocytosis at reduced versus neutral Ta was investigated as previously described [24, 26]. Briefly, primary microglia cells obtained from wild type, PI3Kγ-/-, and PI3KγKD/KD mice were seeded into 12-well plates and incubated at 37°C (5% CO2) for 24 h. After attachment, cells were starved for 24 h in DMEM without FCS. Cell were subsequently stimulated with LPS (100 ng/ml) or left unstimulated. Phagocytosis assay was performed by using fluorescein isothiocyanate (FITC)-labeled Zymosan A (S. cerevisiae) BioParticles (9800U/ml) (#Z2841, Thermo Fisher Scientific, Waltham, USA). 7 µl of the suspended particles was added to the microglial cells and incubated 1 h at either 37°C or 33°C. After incubation the cells were fixed with 4% PFA, washed three times and stained with DAPI–solution for 5 min (1:1000 in 1 Í PBS). Phagocytosed particles and cells of five independent visual fields were counted under a fluorescence microscope (Nikon Eclipse Ti, Nikon Instruments - Japan). The result of the phagocytosis of primary microglia was calculated by determining the phagocytic index (the uptake rate of FITC-Zymosan particles per cell).
In Vivo Phagocytosis Assay
Experiments were performed on adult (10–14 weeks) wild type, PI3Kγ-/-, and PI3KγKD/KD mice (7 mice per group) kept during the whole experimental period at neutral Ta or reduced Ta, respectively. To investigate the effect targeted PI3Kγ mutation on microglial phagocytosis FITC-labeled Zymosan particles (9800 U/ml) were administered into the brain as described previously [24]. Briefly, mice were anesthetized by intraperitoneal injection of ketamine (100 mg/ kg) and xylazine (16 mg/kg), and positioned in a stereotaxic apparatus (Stoelting, Wood Dale, IL, USA). The skull was exposed by a skin incision, and small burr holes were drilled through the skull. Using a micromanipulator a cannula (diameter 0.24 mm) attached on a Hamilton microsyringe (10 µl) was stereotaxically placed into the parietal cortex on both sides (stereotaxic coordinates were AP, - 2.0 mm; L, ± 0.5 mm; and V, - 2.5 mm, respectively [27]). Subsequently, 4 µl of FITC-labeled Zymosan particles suspended in artificial cerebrospinal fluid were infused within 120 seconds. The cannula remained in place for 5 minutes before removal. Twenty-four hours later mice were deeply anesthetized and perfused with 4% PFA in phosphate buffer by cardiac puncture via the left ventricle. Brains were removed immediately after fixation and post-fixed for 5 h in 4% PFA at 4°C. After cryoprotection in PBS containing 30% sucrose, brains were frozen in methylbutane at -30°C and stored at -80°C. Whole brains were cut by coronal sections at 40 µm on a freezing microtome (Microm International GmbH, Thermo Scientific, Germany). The slices were immunostained with anti-Iba1 antibody to visualize microglia. A voxel with an edge length of 400 µm, and an altitude of 40 µm were predefined as region of interest. Z-stack imaging was performed with a 20Í objective using a digital fluorescence camera (Nikon DS-Qi2), mounted on the Nikon inverted research microscope Eclipse Ti (Nikon Instruments Europe B.V., Amstelveen, The Netherlands). Quantitative measurements (ImageJ software, National Institutes of Health, Bethesda, MD) blinded to the treatment groups were used to count the percentage number of Iba-1 positive cells per mm3 containing Zymosan particles.
Histopathology and immunohistochemistry
For determination of microglial activation, PMN homing, MMP-9 expression, and TUNEL positivity, brains were fixated in situ by transcardial perfusion with 4 % PFA after rinsing with PBS. Afterwards, they were immediately removed after fixation, post-fixated in 4 % PFA at 4 °C for 1 day, embedded in paraffin and cut into 6-μm-thick sections. After deparaffinization, the sections were heated with citrate buffer (0.01M, pH6.0) in the microwave (630W, 11min) for antigen removal and the nonspecific binding sites were blocked with blocking solution (5% NDS, 1% BSA-c, PBST). Then, the slide-mounted tissue sections were incubated with the desired primary antibody in antibody incubation solution (5% NDS, 1% BSA-c, PBST) at 4 °C overnight, followed by an incubation with the associated secondary antibody at 4 °C for 1 h. Negative control sections were incubated with goat serum in absence of the primary antibody. The following primary antibodies were used: goat polyclonal anti-Iba-1 (1:250) antibody (Abcam, Cambridge, UK) for Iba1 staining, rabbit polyclonal anti-MMP-9 (1:150) antibody (Cell Signaling Technology, Danvers, USA) for MMP-9 and rabbit anti-mouse PMN (ACCURATE CHEMICAL & SCIENTIFIC CO, USA) for neutrophils staining. For visualization, the secondary fluorescent goat anti-mouse isotype-specific antibody Alexa Fluor® 488 (Molecular Probes, Inc., Eugene, USA) and donkey anti-goat IgG antibody Alexa Fluor®568 (Thermo Fisher Scientific, Waltham, USA) were used. Method for TUNEL staining was described elsewhere [28]. Briefly, sections were deparaffinized and prepared for TUNEL-staining. Fragmented DNA was detected in situ by the TUNEL method using a commercially available kit according to the manufacturer’s protocol (In Situ Cell Death Detection Kit, POD; Roche, Germany). Deparaffinized sections were pretreated with 20 mg/ml proteinase K, and washed in PBS prior to TUNEL staining. TUNEL staining was performed by incubation with fluorescein-conjugated digoxigenin-UTP and terminal deoxynucleotidyltransferase at 37°C for 1 h. DNA fragmentation was visualized using converter-alkaline phosphatase, NBT/BCIP and counterstaining with Kernechtrot.
Cell counting for assessment of microglial cell activation: Cells were classified as ramified, amoeboid, unipolar and bipolar. Ramified (normal) microglial cells are defined by thin, slender, radially projecting processes with well-developed ramifications. Amoeboid microglial cells are defined as having large soma, and short, thick and radially projecting processes. Unipolar and bipolar microglial cells were defined as having one or two thick process with well-developed ramifications [29, 30]. Estimation of cell counting migration and phagocytic index were performed by a co-author (G.-P. L.) blinded for genotype and treatment. In each case, evaluation was performed on three different slices obtained from frontal cortex, thalamus and hippocampus, each. Five separate fields of vision were counted with at least 100 cells.
Statistics
The statistical analysis was performed using SigmaPlot Software (Sigma-Plot Software, San Jose, USA). All data are presented as boxplots illustrating medians within boxes from first quartile (25th percentile) to the third quartile (75th percentile) and whiskers ranging from the 10th to the 90th percentiles (extreme values are marked outside). Numbers of animals are given in figure legends for each group and time point. Comparisons between groups were made with one-way or two-way analysis of variance, if appropriate. In case of repeated measurements, one-way and two-way analysis of variance with repeated measures was used, if appropriate. Post hoc comparisons were made with the Holm–Sidak test or t-tests with Bonferroni’s correction for adjustments of multiple comparisons. Data not following normal distribution was tested with Kruskal-Wallis test followed by Dunn’s multiple comparisons test.