Cell culture and reagents
The human ALL cell lines (BV173, NALM6, JM-1, NALM1, RS6 and SUPB15) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured in DMEM supplemented with 10% FBS (Hyclone; Cytiva) at 37℃ with 5% CO2 in a humidified incubator. ALT and rapamycin were obtained from MedChemExpress (New Jersey, USA). Both the tested compounds were dissolved in DMSO. The final concentration of DMSO in culture medium did not exceed 0.1%.
Cell viability assay
Cell viability was assessed using a MTT assay kit (Sigma-Aldrich; Merck KGaA). BV173 and NALM6 cells were seeded in 96-well plates and then treated with 1, 5 and 10 μM of ALT for 24 h. Subsequently, 10 μl 5 mg/ml MTT solution was added, and incubated at 37°C for 2 h. MTT solvent was then added to the culture. Absorbance was measured at 570 nm using a microplate reader. Each experiment was performed at least three times.
RNA sequencing
All of the RNA-sequencing procedures were performed by the Beijing Genomics Institute (BGI, Shenzhen, China). Briefly, BV173 and NALM6 cells were treated with ALT (5 μM) and control (0.1% DMSO) for 24 h. Total mRNA was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and reversed transcribed into a library of cDNA fragments using TruSeq Stranded mRNA LTSample Prep Kit (Illumina, Inc., San Diego, USA). Subsequently, these samples were sequenced on the Illumina HiSeq 4000 platform (Illumina, Inc. San Diego, USA). Statistical analysis was performed using the ALEXA-seq software package, and differentially expressed genes (DEGs) were selected based on a selection criteria of a fold change ≥2, P< 0.05 and false discovery rate <0.05.
Plasmids transfection
The small interfering (si)RNA for AP2M1 (si-AP2M1), Beclin1 (si-Beclin1), pcDNA3.1 vector AP2M1 overexpression vector and negative controls were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). The sequences of siRNA were: si-AP2M1, GGGUGGUGAUGAAGAGCUACC and si-Beclin1, GGUGUUUGAUACUGUUUGAGA. Plasmids were transfected into ALL cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol.
Colony formation assay
Cells were seeded in 12-well plates (500 cells/well) and incubated for 14 days and then fixed with 4% paraformaldehyde for 15 min. The fixed cells were stained with 0.1% crystal violet, and then imaged using a microscope. The number of visible cell colonies were recorded.
Cell apoptosis
Following treatment with different concentrations of ALT, both BV173 and NALM6 cells were harvested and washed with PBS 3 times. For cell apoptosis analysis, cells were labeled with Annexin V-Fluorescein Isothiocyanate (FITC)/propidium iodide (PI) according to manufacturer’s protocol. Finally, cells were observed and imaged using a BD FACSCalibur flow cytometry system (Becton Dickinson, NJ, USA).
JC-1 staining
JC-1 staining was used to assess the mitochondrial membrane potential (MMP) using a JC-1 assay kit (Beyotime Institute of Biotechnology, Shanghai, China) according to the manufacturer’s protocol. Images were obtained using a fluorescence microscope (Leica, Wetzlar, Germany). The ratio (%) of red/green fluorescence intensity was calculated using ImageJ version 2.1 (National Institutes of Health, Bethesda, MD, USA).
Western blot analysis
Anti-AP2M1, anti-cytochrome C and anti-cleaved caspase-3 antibodies were obtained from Abcam (Shanghai, China). Anti-Beclin 1, -p62, -LC3, bcl-2, -bax, -cleaved-caspase3 and GAPDH antibodies were obtained from ProteinTech (Shanghai, China). Total proteins were extracted using RIPA-lysis buffer supplemented with 10 mM PMSF (Beyotime Institute of Biotechnology, Shanghai, China). A bicinchoninic acid assay was used to quantify protein concentrations. A total of 40 μg protein was loaded on a 10% SDS-gel, resolved using SDS-PAGE and transferred to polyvinylidene fluoride membranes. Then, the membranes were blocked with 5% nonfat milk in Tris-buffered saline and 0.1% Tween 20 (TBST), and incubated with primary antibodies at 4°C overnight. The following day, the membranes were washed 5 times with TBST, the membranes were then incubated with secondary antibodies for 2 h. An enhanced chemiluminescence system kit (Beyotime Institute of Biotechnology, Shanghai, China) was used to visualize the signals. Densitometry analysis was performed using ImageJ.
Immunofluorescence
BV173 and NALM6 cells were re-suspended to prepare cell suspensions following treatment with the designated reagents. A total of 40 µl cell suspension was dropped on coverslips. Subsequently, the coverslips covered with cells were dried in an oven at 50°C, and then washed with PBS. Next, cell coverslips were fixed in 4% paraformaldehyde for 15 min, and permeabilized with 0.2% Triton X-100 for 15 min. Subsequently, the cells were sealed with 5% BSA solution at 37°C for 40 min, and then incubated with anti-AP2M1 primary antibodies at 37°C for 4 h. The cells were incubated with the Alexa Fluor®-594 or 488 secondary antibodies (Abcam, Shanghai, China) at 37°C for 1 h and stained with DAPI for 3 min. Finally, antifade mounting reagent was placed on the slide and covered with a cell-coated glass sheet. The glass slides were observed using a fluorescence microscope (Leica, Wetzlar, Germany). ImageJ was used to measure the fluorescence intensity.
Confocal analysis
For confocal microscopy, the GFP-LC3 vector was transfected into the BV173 cells to generate a stable GFP-LC3 BV173 cell line. Following treatment, the GFP-LC3 BV173 cells were fixed in 4% paraformaldehyde for 15 min. Subsequently, the cells were permeabilized using 0.05% Triton X-100 and stained with DAPI (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Cells were examined and quantified using an AOBS confocal laser scanning (Leica, Wetzlar, Germany).
Xenograft model
Experiments were performed in BALB/c nu/nu mice (6 weeks old), which were obtained from Charles River Laboratories, Inc. Wilmington, MA, USA. A total of 3x106 BV173 cells transfected with AP2M1 siRNA in 100 μl PBS were subcutaneously injected into the posterior flank region of nude mice. The long diameter and short diameter of tumors were measured every 2 days, and the volume was calculated as follows: Tumor volume =0.5x long diameter x short diameter2. The mice were treated with ALT every day after injection for 15 days. Finally, the mice were sacrificed and the tumors were excised.
Statistical analysis
SPSS version 22.0 (IBM, Corp.) was used to analyze the data. Data are presented as the mean ± standard deviation. A one-way ANOVA followed by a Tukey’s post hoc test was used to assess the difference between multiple groups. Differences between two groups were analyzed using a Student’s t-test. P < 0.05 was considered to indicate a statistically significant difference.