Human brain samples
Human frontal cortex samples from DLB cases (n = 8) and age-matched neurologically unimpaired controls (n = 8) were obtained from the Alzheimer Disease Research Center (ADRC) at University of California, San Diego (UCSD) (Table 1). The diagnosis was based the initial clinical presentation of dementia followed by parkinsonism and the presence of cortical and subcortical α-syn-positive Lewy bodies [7].
Mice
To characterize T cell populations in response to progressive deposition of α-syn we performed flow cytometry and immunohistochemistry in 10–11 months old α-syn tg (mThy1, line 61, n = 12) mice and age-matched non-tg littermates (n = 12) [49, 50]. We selected this particular PD/DLB model because α-syn tg mice of this age display considerable accumulation of α-syn in cortical and subcortical regions, degeneration of neurons in the deeper layers of the neocortex and limbic system, axonal degeneration in the striatonigral system, microglial and astrocytic activation, and release of IL-1β, IL-6, and TNFα [46, 47]. All mice used in this study were bred at UCSD and transferred and analyzed at the National Institute on Aging (NIA) in the Baltimore campus.
Tissue Collection
All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the NIA and institutional guidelines for the humane treatment of animals. Mice were divided into two groups: one group (α-syn tg, n = 4; non-tg, n = 4) was perfused with PBS for immunohistochemistry with paraffin processing and PCR, the other (α-syn tg, n = 8; non-tg, n = 8) was not perfused and used for flow cytometry and immunohistochemistry with vibratome processing. For flow cytometry, brains were minced into smaller pieces and then pressed through a 100 µm cell strainer. The brain suspension was pelleted by centrifugation, resuspended in 1 ml of 22 U Liberase TL (Roche, Basel, Switerland) and 50 mg/ml of DNaseI (Millipore Sigma, St. Louis, MO), and incubated at 37 °C for one hour. For immunohistochemical analysis, perfused mouse brains were fixed in 70% EtOH and embedded in paraffin for serial sectioning at 6 µm with a microtome. Non-perfused mouse brains were fixed in 4% PFA for vibratome sectioning at 40 µm.
Flow Cytometry Analysis
Cells were incubated with Fc Block (CD16/32, BD Biosciences, San Jose, CA), stained with antibodies and then fixed with 2% PFA. Samples were acquired on the FACS Canto II (BD Biosciences) and analyzed using FlowJo (TreeStar, Ashland, OR). Dead cells were excluded using the eBioscience Fixable Viability Dye eFluor® 506 (ThermoFisher Scientific, Waltham, MA). The following antibodies were used: anti-CD8 (53 − 6.7) and anti-TCR-γδ (ebioGL3) from Thermo Fisher Scientific; anti-CD4 (GK1.5), anti-CD19 (6D5), anti-CD11b (M1/70), and anti-CD45 (30-F11) from BioLegend, San Diego, CA; and anti-TCR-β (H57-597) from BD Biosciences. APC-conjugated mouse CD1d tetramers loaded with glycolipid PBS-57 (CD1d-tet) and an unloaded tetramer comprised of only the glycolipid PBS57 were obtained from the tetramer facility of the National Institutes of Health (NIH).
Gene Expression Analysis
Brains from α-syn-tg mice and non-tg littermates were collected for RNA extraction and qPCR analysis. Briefly, brains were disrupted and homogenized using a TissueRuptor II, and RNA was extracted from lysates using the RNeasy mini kit (Qiagen Venlo, Netherlands). DNA was eliminated from the samples by incubating with DNase (Qiagen). First strand cDNA synthesis was performed by using 1 µg of total RNA together with oligo(dT)12− 18 and the Invitrogen SuperScript II Reverse Transcriptase (Thermo Fisher Scientific), according to the manufacturer's instructions. Quantification of cytokine mRNA expression was conducted using real-time qPCR performed on an Applied Biosystems ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific). Primers were designed to amplify specific amplicons of IFNG (F:5’- agaccagtggtctaccaggt − 3’; R:5’- taagtcacactttgtctctgtg − 3’), IL-2 (F:5’- tggagcagctgttgatggacc − 3’; R:5’- tggcctgcttgggcaagtaa-3’), IL-4 (F:5’-agatcatcggcattttgaacg − 3’; R:5’-tttggcacatccatctccg-3’), IL-12b (F:5’-gttcgaatccagcgcaaga − 3’; R:5’- cgaggaacgcacctttctg − 3’), IL-10 (F:5’- ggcgctgtcatcgatttctc − 3’; R:5’- atggccttgtagacaccttgg − 3’), IL-17F (F:5’- ctgttgatgttgggacttgcc − 3’; R:5’- tcacagtgttatcctccagg − 3’), TGFB1 (F:5’- tcactggagttgtacggcagtg − 3’; R:5’-tcgaaagccctgtattccgtc − 3’), TNF (F:5’- tcgtagcaaaccaccaagtg − 3’; R:5’- ggatagacaaggtacaacc − 3’) and gapdh (F:5’-gtcgtggagtctactggtgtc; R:5’cagaaggggcggagatgatg-3’) genes. Quantification of gene expression was performed by the E^− ΔCt method using gapdh as the normalizer gene (where E stands for primer amplification efficiency). Each sample was quantified in triplicate and primer amplification efficiencies were calculated and validated with the standard curves obtained through the amplification of cDNA serial dilution.
Immunohistochemistry, double labeling and image analysis
Briefly, as previously described [51], paraffin (6 µm) and vibratome (40 µm) sections of human and mouse brains were incubated overnight at 4 °C with primary antibodies: CD3 (abcam ab16669, rabbit monoclonal 1:100, T cell marker), CD4 (abcam ab183685, rabbit monoclonal 1:1000, helper T cell marker), CD8 (abcam ab203035, rabbit polyclonal 1:500 Tris buffer treatment, suppressor T cell marker), CD1d (BioXCell BE0179, rat monoclonal 1:500, NKT cell marker), CD20 (Thermo Fisher Scientific PA5-16701, rabbit polyclonal 1:500, B cell marker), glial fibrillary acidic protein (GFAP) (Millipore MAB3402, mouse monoclonal 1:1000, astroglial cell marker), Iba1 (Wako chemical 019-19741, rabbit polyclonal 1:1000, microglial cell marker), SYN-1 (BD Biosciences 610787, mouse monoclonal 1:1000, ⍺-syn). Sections were then incubated in biotin-tagged anti-rabbit or anti-mouse or anti-goat IgG1 (1:400, Vector Lab) secondary antibodies, treated with Avidin DHRP (1:200, ABC Elite, Vector Lab), visualized with diaminobenzidine (DAB, Vector Lab), and imaged with Zeiss wide field microscope. For double immunolabeling, vibratome (40 µm) brain sections were incubated with the following antibody combinations: IFN𝛾 (R and D systems AF-585, goat polyclonal 1:200)/CD3; GFAP/CD3; Iba1/CD3 and human ⍺-syn (Life Technologies SYN211, 1:1000, mouse monoclonal)/CD3. For each combination, markers were visualized with FITC-tagged and Texas-red secondary antibodies, respectively. Nuclei were stained with DAPI (Hoechst 33258), and the sections mounted under glass coverslips with anti-fading media (Vector Lab).
All sections were processed and imaged under the same standardized conditions and blind coded. Four fields from the frontal cortex, hippocampus, striatum, and thalamus were examined for each section and performed in duplicate for each mouse. Sections visualized with DAB were imaged with an Olympus BX41 microscope and analyzed with the Image Quant 1.43 program (NIH) to determine the number of CD3+, CD4+, CD20+, CD8+, CD1d+, GFAP+, and Iba1 + cells per field (230 µm x 184 µm). Double immunolabeled were imaged with an Apotome II mounted in a Carl Zeiss AxioImager Z1 microscope. Optical sections (0.5 µm thick) were analyzed via the Zen 2.3 platform to determine % CD3 cells displaying IFN𝛾 immunoreactivity. Double labeled images were also used to determine average number of GFAP or Iba1 positive processes over CD3 cells, and average proximity of CD3 cells to neurons displaying human ⍺-syn-positive aggregates.
Statistical Analysis
Values shown in the figures are presented as mean ± SEM. P-values for determination of the statistical significance of differences were calculated using unpaired Student’s t-test.