Prospective observational study of dihydroartemisinin-piperaquine treatment of vivax malaria in North Sumatera, Indonesia

doi:10.21203/rs.3.rs-2198036/v1

Download PDF

Research Article

Prospective observational study of dihydroartemisinin-piperaquine treatment of vivax malaria in North Sumatera, Indonesia

https://doi.org/10.21203/rs.3.rs-2198036/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objectives. Plasmodium vivax malaria treated by dihydroartemisinin-piperaquine (DHA-PPQ) in Indonesia remains a challenge. Plasmodium falciparum resistance to DHA-PPQ was documented in Asia and it is suspected that this will also be a concern for P. vivaxmalaria. Thus it is needed to test the sensitivity of P. vivax on a regular basis. Parasite clearance time (PCT) and molecular markers of resistance are efficient sentinel tools for this goal.

Methods. A prospective observational study was conducted at North Labuhan Batu Regency (Sumatra). The outcome were the clinical and parasitological efficacy of the 3-day DHA-PPQ therapy corrected by PCR and the prevalence of Pvmdr1, PvK12 and PvPM4 molecular markers of chloroquine and DHA-PPQ resistance.

Results. During the 6-months study period, 100 patients were included and 6 were lost to follow-up. Ninety-four patients were included in the per-protocol analysis. The parasite clearance half-life increased over 18h in 8.5% of the cases while no clinical recurrence were observed during the Day-28 follow-up. None of the molecular marker of ACT resistance were detected among the samples tested.

Conclusions. This study highlighted the need for active surveillance of ACT efficacy against P. vivax malaria in Indonesia, using simple method such as PCT during observational studies, as it may provide a cost-effective early warning signal.

Plasmodium vivax (P. vivax) malaria remains a public health issue in many areas of Indonesia archipelago after Plasmodium falciparum (P. falciparum) malaria was limited to few regencies [1–3] and while Plasmodium knowlesi may be a new threat for the future [4]. Plasmodium vivax resistance to chloroquine emerged more than a decade ago, mostly in south-east Asia, including Indonesia and Papua New Guinea [5–7]. High-grade chloroquine-resistance led those countries to recommend artemisinin-based combined therapies (ACTs) for all parasites species, naming dihydroartemisinin-piperaquine (DHA-PPQ) in Indonesia and artemether-lumefantrine (AL) in Papua New Guinea [8, 9]. But in the meantime, P. falciparum resistance to DHA-PPQ was documented in Cambodia and it must be anticipated that DHA-PPQ resistance can become a concern for P. vivax malaria in the future. In this context, it is of utmost importance to detect a decreased sensitivity of P. vivax to DHA-PPQ before significant therapeutic failures occurred. For that purpose, systematic survey of parasite clearance time (PCT) and molecular markers of resistance are useful tools. Delays in PCT were indeed the first observations in south-east Asia reporting a decrease efficacy of artemisins against P. falciparum [10, 11]. Delayed PCT was clearly identified as a risk factor of recurrence at day 28 for chloroquine treatments during P. vivax malaria [8, 12]. The parasite clearance time should be measured with accurate and reproducible methods to allow an effective survey of early events. These methods were tested during the last decade [13] leading to recommendations from the WorldWide Antimalarial Resistance Network (WWARN) (https://www.wwarn.org/parasite-clearance-estimator-pce ). However, the recommended blood sampling every 6 hours until two consecutive negative parasite counts is difficult to implement in standard clinical care facilities and activities. Most of the data on delayed PCT obtained so far came from falciparum malaria studies, while there is no consensus on the threshold between normal and delayed PCT due to the multivariable nature of this data. The P. vivax parasite clearance time is far less documented and the model used for P. falciparum may be less relevant to discriminate between drug efficacy or resistance based on normal or delayed PCT. During a study conducted in 2001–2002 in Cambodia, parasites clearance time after DHA-PPQ treatment of uncomplicated P. vivax malaria was 12h [12–18] confirming a rapid efficacy [14]. More recently, during a study conducted in Vietnam, the P. vivax PCT was in the same range (18h [12–18]) [15].

Molecular markers of P. vivax drug resistance are less discriminant than those of P. falciparum [16, 17]. Three main genes (Pvmdr1, PvK12 and PvPM4) presenting single nucleotide polymorphisms were associated with P. vivax resistance to chloroquine, artemisinin and piperaquine, respectively. In 2005, Brega et al. were the first to describe the role of P. vivax mdr1 gene (Pvmdr1) in chloroquine resistance [18]. This marker was tested in different areas [6, 19–25]. These studies did not show a definitive relationship between the presence of mutations of this gene and sensitivity of the parasite to quinolone. Studies conducted in south-east Asia helped to clarify the role of Pvmdr1 in antimalarial drug resistance [26–28]. Recently, a potential molecular marker or artemisinin resistance was identified in the gene Plasmodium vivax k12, ortholog of the P. falciparum Pfk13. It was observed that non-synonymous mutations in this gene were circulating at very low frequencies in Cambodia [29]. Studies conducted later in south-east Asia confirmed the limited polymorphism of Pvk12 making the role of this gene in artemisinin resistance unclear [30, 31]. Lastly, resistance to piperaquine was suspected to be associated with I165V variant or increased copy number of Plasmepsin IV gene (PvPM4), an orthologue of P. falciparum plasmepsin II [32].

Dihydroartemisinin-piperaquine is used as first-line therapy in Indonesia since a decade but evaluation whether this drug is still effective against P. vivax was seldomly conducted. In this context, sentinel surveillance of P. vivax sensitivity to antimalarials is needed [26]. Thus, a prospective observational study was conducted at North Labuhan Batu Regency (Sumatera, Indonesia) where P. vivax is predominant [2] and treated with DHA-PPQ.

The primary outcome of this study was the. the clinical and parasitological efficacy of the 3-day DHA-PPQ therapy corrected by PCR and the prevalence of Pvmdr1, PvK12 and PvPM4 molecular makers of chloroquine and DHA-PPQ resistance.

This was an observational study conducted at Tanjung Leidong Health Centre in Kualuh Leidong District, North Labuhan Batu Regency, from July to December 2018. The district is a coastal area which covers an area of 394 sq km with a population of more than 29,552. Plasmodium vivax is the predominant species in this location. Tanjung Leidong Health Centre offers malaria diagnosis using microscopy and treatment was free for the people. Dihydroartemisinin-piperaquine has been used as drug of choice for P. vivax malaria in Indonesia since 2010. Any person with a fever or a history of fever within 48h who visited the health centre and did not took anti-malarial drugs within the four weeks prior to the study, was selected as a study participant. Individuals who refused to participate were not included. . Individuals who had a P. falciparum infection or where unable to follow-up, were excluded. Antimalaria treatments were provided by Ministry of Health. Dihydroartemisinin–piperaquine (containing 40 mg dihydroartemisinin and 320 mg piperaquine) was ad ministered once daily for 3 days following the National guidelines. Dihydroartemisinin–piperaquine was taken in front of the healthcare staff for 3 consecutive days. In addition, patients with P. vivax malaria were prescribed primaquine (0.25 mg/kg/day for 14 days). All patients were followed up to day 28.

Microscopy for malaria diagnosis

Thick and thin blood smears were prepared on the same slide from samples obtained from each patient with acute febrile illness;. Each slide was stained with a 3% Giemsa solution for 45 min. All sample slides included in this study were examined by a single field microscopist. For positive smears, the numbers of parasites were counted against 200 white blood cells (WBCs) in thick smears or 500 WBCs for low-density infections. Parasite density was calculated assuming 8000 WBCs per μl. The thin smears for the positive samples were examined for species identification. All slides positive at inclusion were sent to Eijkman Institute, Jakarta, for quality control.

Parasite clearance half-life

The parasite clearance half-life (PC_1/2) was determined using T_1/2 = log_e(2)/K derived from the linear segment of the log parasitemia–time curve. The Worldwide Antimalarial Resistance Network (WWARN) Parasite Clearance Estimator (PCE) was not used because the 6-hourly blood sampling required was not possible during this study. However, the PC_1/2 at admission was calculated from the first three samples during the log-phase at H0, H24 and H48. We defined the threshold for PC_1/2 as 12-18 hours (<12H: normal, 12-18: suspect, > 18: increased).

Molecular analysis

DNA was extracted from blood-spot samples on filter paper according to the spin-column method using the QIAamp DNA Mini Kit, according to the manufacturer’s instructions (Qiagen, Germany) and eluted in a total volume of 150 µl for each sample. The identification of species was confirmed by real-time PCR using species-specific primers [33]. All amplification reactions were carried out in a total volume of 20 µl and the presence of 250 nM of each oligonucleotide primers and 2.0 µl of Light Cycler Fast Start DNA Master SYBR Green 1 reaction mix. Primary amplification reactions were initiated with 5.0 µl of the template genomic DNA, and 1.0 µl of the product of these reactions was used to initiate the secondary amplification reactions.

Genotyping of Pvcsp, and Pvmsp1

Two genes (Pvcsp, Pvmsp1) were used to compare the sequences on admission and on recurrence at D7, D21 and D28. PCR reactions were performed in a total volume of 30 µl containing 1 µM of each primer, Mix Hotstart 5X (Solis Biodyne), 12.5 mM MgCl₂ and 2µL of genomic DNA. Before sequencing, all PCR products were purified using ExoSap-it (Thermofisher). Sequencing was carried out by Biofidal-MicroSynth (Lyon, France) using BigDye V3.1 Terminator Cycle Sequencing kit (Thermofischer), purification by BigDye-X- Terminator, on ABI-3730XL sequencer.

Plasmodium vivax circumsporozoite (Pvcsp) gene comprises a central repetitive domain of a 27 bp element repeated a variable number of times [34]. . Two types of repeats have been described, VK210 (type I: GDRADGQPA) and VK247 (type II: ANGAGNQPG). The confirmation of sequences was performed by BLAST and nucleotide sequences were translated into amino acid sequences. BioEdit version 7.2.5 was used to analyze and control the DNA sequences. MUSCLE (MUltiple Sequence Comparison by Log-Expectation) was used for sequence alignment.

PCR amplification of Pvmdr1, PvK12 and PvPM4 genes

PCR reactions were performed in a total volume of 30 µl containing 1 µmol/L of each primer, Mix Hotstart 5X (Solis Biodyne) - 12,5 mmol/L MgCl₂, 10X GC Enhancer (Solis Byodine), and 2µL of genomic DNA. Before sequencing, all PCR products were purified using ExoSap-it (Thermofisher). Sequencing was carried out by Biofidal-MicroSynth (Lyon, France) using BigDye V3.1 Terminator Cycle Sequencing kit (Thermofischer), purification by BigDye-X- Terminator, on ABI-3730XL sequencer. Consensus sequences were obtained using Chromas Pro (Technelysium Pty). Primers sequences and PCR program are presented in Table 1.

Table 1: Primers used for the amplification of pvcsp, pvmsp1, pvmdr1, pvk12, and pvpm4

Genes

Primers

Sequences 5’ – 3’

PCR cycling

Product size (bp)

Pvcsp

Pvmsp1

Pvmdr1

Pvk12

Pvpm4

PvCSP-Ofidt PvCSP-Oridt

PvMSP1-icb-F1

PvMSP1 F3-O3R

PvMSP1-NestF2

PvMSP1-N3R

PvMDR1-Fidt

PvMDR1-Ridt

PvMDR1-F1

PvMDR1-R1

PvK12_F1-F

PvK12-c2216R

PvK12_F1-idt

PvK12_R1-idt

PvK12_F2-idt

PvK12_R2-idt

PvK12_F3-idt

PvK12_R3-idt

PV_PM4F1_F

PV_PM4F2_R

PV_PM4F1_R

PV_PM4F2_F

GACGAGGAAGGAGATGCTAAA CGTACATACAGTTACGTGCAAAC

CCCTACTACTTGATGGTCCTC

GTTGTTACTTGGTCTTCCTCCC

AGCATGATCGCCACTGAGAAG

ATTACTTTGTCGTAGTCCTCGGCGTAGTCC

CTGGAGGCGAACTCGAATAAG

CCCTTCCTTGGAGGAACTAAAC

ATAGTCATGCCCCAGGATTG

ACGTTTGGTCTGGACAAGTAT

CCATACGTAAACGCTGCAAAT

ACAGCAACAGCGACGATAA

GTGTTAGGGTGTGCCTAGAAG

CGAATATCGCAACGGAGACTAT

CTACCCAAGCCTTCATCCTATG

TCCATGGAGCTGTTAGACATTAG

CTCATTCGTGTCTGGAGAGAAA

TCAAAAGGAGTACGAAGCATACAA

TGTTCTAATTACAGCACCAACACA

ATGGGTTCTAAATCATCAGTGTCA

GATGCAGCATTAAAAATCTGTACG

96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2 min) 35 cycles, 72° 10 min

96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min

96°C 12 min (96°C 20 sec, 54°C 20 sec, 72 °C 2 min) 35 cycles, 72° 10 min

96°C 12 min (96°C 20 sec, 52°C 20 sec, 72 °C 2min) 35 cycles, 72° 10 min

95 °C 10 min (95 °C 30s, 62 °C 30s, 72 °C 150s) 40 cycles

95 °C 10 min (95 °C 30s, 62 °C 30s, 72 °C 150s) 30 cycles

1087

1827

1705

1211

783

2139

980

728

912

1703

807 - 1086

Pvcsp: P. vivax circumsporozoite surface protein, Pvmsp1: P. vivax merozoïte surface protein 1 , Pvmdr1: P. vivax multidrug-resistant ; Pvk12 : P. vivax kelch12 propeller domain , Pvpm4: P. vivax plasmepsine 4.

Ethical clearance

Explanations regarding the study were given to the participants before the samples were collected. The Ethical Committee of the Medical Faculty Universitas Sumatera Utara/Adam Malik General Hospital (No. 588/TGL/KEPK FK USU-RSUP HAM /2018) approved the study. Written informed consent was obtained from each of the study participants, or from the parents or guardians of the children who were included. Material Transfer Agreement between Universitas Sumatera Utara and Lyon University was provided before the samples shipment. The samples shipment was made in agreement with the Nagoya Protocol on Access to Genetic Resources and the Fair and Equitable Sharing of Benefits Arising from their Utilization.

Population description and clinical/parasitological outcomes

During the 6-months study period, 134 patients were eligible for inclusion (Figure 1). Thirty-four patients (25%) were not included due to P. falciparum infection detected by microscopy (14), inability to e follow-up (12), or no consent given (8). Among the 100 patients included, 6 were lost to follow-up at day 21 (2) and day 28 (4). Ninety-four patients were included in the per-protocol analysis. The demographic information of included patients for the intention-to-treat analysis (ITT) (n=100) were: age: mean=23.5 and the sex ratio (M/F) = 1.6 (61/39). All the patients presented simple or mild malaria and none experienced severe disease. Most of the symptoms were fever, headache, chills sweating and myalgia. These symtoms resolved at day 1 or day 2 after treatment without significant side effect. None of the patient experienced a clinical recurrence during the day 28 follow-up.

Parasite clearance using microscopy

The mean parasitemia at inclusion (D1) was m= 5180 [10 - 49600] parasites/µL. Blood samples were collected during the dihydroartemisinin-piperaquine treatment immediately before drug administration at H24 and H28 (± 3 hours) to estimate the parasite clearance time. At H24 and H48 following treatment, 89/94 patients (94.7%) and 53/94 (56.4%) had detectable parasitemia, respectively. Surprisingly, 10/94 (10.7%) had a residual parasitemia at day 7 post-treatment, 1 patient at day 21 and 5 patients (5.3%) at day 28. None of these residual parasitemia observed by microscope was associated with fever or symptoms and none of these patients received salvage treatment.

Almost half of the patients (44/94 ; 46.8%) carried sexual forms of the parasite at admission. During the follow-up, the decrease in asexual and sexual forms evolved in parallel.

Parasite clearance half-life

The PC_1/2 was calculated using the first three samples (H0, H24 and H48) for the 53 patients still presenting a positive parasitemia at day 2. No lag phase can be detected due to the lack of sampling between admission and H24. Based on this subgroup, 39/53 patients (73.5%) showed a parasite clearance time between 6 and 12 hours which was considered as normal efficacy. There was no correlation between the initial parasitemia at inclusion and the parasite clearance time (R= 0.22).

Surprisingly, 6 patients had a parasite clearance considered as suspect (12< PC_1/2<18h), and 8 patients (8/94; 8.5%) had a significantly increased parasite clearance time using microscopy: > 18 hours (26.3 [18 - 45]).

Parasite clearance by RT-PCR

Molecular data were obtained from 85 out of 94 samples. Using real-time PCR data from filter papers, the percentage of patients with residual parasitemia at H24 and H48 were 50 and 44.6%, respectively. Five patients presented a positive microscopy at day 28 and this was confirmed by a positive PCR for 2 of them. The PC_1/2 was not increased for these cases.

Distinguishing between treatment failures and new infections or relapses

Parasite samples collected at admission were genotyped and compared to parasite samples collected at D7, D14, D21 or D28 when a residual parasitemia was detected.

Sixteen samples collected at admission were compared to 1O samples collected at D7, 1 at D21 and 5 at day 28.. All the samples collected at admission displayed the Pvcsp VK210 type (Type 1: GDRADGQPA) with two haplotypes (8 repeats of GDRADGQPA / 9 repeats of GDRAAGQPA and 4 repeats of GDGAAGQPA / 13 repeats of GDRAAGQPA). Similar patterns were obtained with samples collected during the follow-up at the different time points. Correct sequences of the F1 fragment of Pvmsp1 from samples at admission and 13 samples out of 16 collected during the follow-up were obtained, given a single haplotype of five short tandem repeats (tripeptides) for all samples.

Molecular markers of drug resistance:

We searched for single nucleotide polymorphisms known to be associated with drug resistance in Pvmdr1, PvK12 and PvPM4 genes from samples collected at admission.

We obtained correct pvmdr1 sequencing for 59 samples out of 85 collected at DO. The missing sequences were due to poor quality of extracted DNA. All these samples displayed the 958 M/ 976 F/ 1076 L associated with chloroquine resistance. No polymorphism in the pvkelch12 V552I or in the Pvpm4 V165I was detected among thesamples collected at D0 and during the follow-up at D7, D21 or D28.

Dihydroartemisinine-piperaquine is the first line drug for P. vivax malaria in Indonesia since 2010. This studyconfirmed its excellent clinical efficacy. There is no doubt that this ACT regimen should be maintained in the near future. However, artemisinin-derivatives resistance of P. falciparum was detected a decade ago in south-east Asia and huge efforts were needed to contain the spread of this resistance. A similar scenario should be considered if the ACTs used to treat P. vivax malaria in the same area start to face decreased efficacy. Thus, it is needed to conduct observational studies to allow a very early detection of any signs of decreased efficacy. Small scale observational studies are easier and cheaper than drug efficacy blinded clinical trials and thus it can be reiterated at a country level to provide early signals of decreased efficacy. Such observational studies can confirm the efficacy of a regimen or detect signals justifying larger studies to document the trend toward resistance.

Thus, an observational study was conducted in Kualuh Leidong District, the coastal area of North Labuhan Batu Regency, located in North Sumatera, Indonesia. Patients presenting P. vivax malaria and treated with DHA-PPQ were included and follow-up until day 28. Blood samples were collected during the follow-up for microscopy and molecular tests were performed after the end of the clinical study. Two main parameters were used to evaluate the overall drug efficacy against P. vivax: the parasite clearance half-life and a panel of suspected molecular markers of drug resistance (Pvmdr1, PvK12 and PvPM4).

Early markers of drug decreased efficacy are delayed parasite clearance time and molecular markers, while both remain unclear in the case of P. vivax. However, clinical and parasitological treatment failure rate may be increased with an unpredictable delay after early signals of decreased efficacy, and most of the time it may be too late to contain the resistance to the drug. Thus sentinel observational studies of DHA-PPQ effect on vivax malaria are worth conducting.

During this study, none of the included patient presented a clinical therapeutic failure. However, 56.4% of patients had detectable parasitemia at H48 post-treatment. Moreover, 10.7% had a residual parasitemia at day 7 post-treatment and 5 patients (5.3%) at day 28. Due to the status of observational study in standard clinical care facilities and activities, it was not possible to follow the WWARN recommendation of 6-hourly blood sampling until two consecutive negative parasite counts to measure the parasite clearance time.

Moreover, those results may be affected by the heterogeneity of clinical care, laboratory experience and sample time collection [35]. Then the PC_1/2 was used in this study to overcome parasite clearance time difficulties and to provide an experimental early warning marker of decreased efficacy.

Using DHA-PPQ to treat P. vivax malaria cases in this study, it was considered that a normal parasite clearance half-life should be below 12hours as previously reported [15]. We defined the threshold for PC_1/2 as suspect for 12–18 hours (“grey zone”) and delayed > 18h (“red zone”). While the majority of the patients (80/94 ; 85%) had a PC_1/2 between 6 to 12 hours, it was increased over 12H for 14 patients, among those 8 had an increase over 18H (26.3 [18–54]. This delay was not associated with initial high parasitemias which may be a confounding factor and there was no correlation between initial parasitemia and parasite clearance time for the whole population. None of the patient with delayed parasite clearance experienced a clinical failure or an increase in body temperature during the 28-day follow-up.

This delayed parasite clearance time may be a relevant signal of decreased drug efficacy since genotype-adjusted estimates of failure rate are greatly impaired by the impossibility to clearly discriminate between recrudescence, relapse or reinfection [26]. In this study, an attempt to detect potential reinfection among patients presenting residual parasitemia during the follow-up was made using Pvcsp and Pvmsp1 genotyping. No polymorphism was detected for both markers between parasite at admission and during the follow-up, precluding any definitive conclusion. In the context of the lack of clear method to discriminate between recrudescence or reinfection during P. vivax malaria, no more evidence can be obtain from these data [26, 36].

None of the molecular marker of ACT resistance were detected among the samples tested, but all of them displayed a mutation associated with chloroquine resistance, which drove the change of first line treatment to ACT in the area a decade ago.

This study highlighted the need for active surveillance of ACT decreased efficacy using PCT or PC_1/2 during observational studies, as it may be a warning signal before resistance detection through clinical therapeutic failure.

One of the limitation of this study is the absence of information on drug absorption and metabolism and absence of therapeutic monitoring of antimalarials. This is inherent of such observational study in routine clinical care according to local facilities, staff available, and resources. The interest of such study is not to provide a definitive and well-documented evidence of therapeutic failure in a specific area, but to act as a sentinel for early detection of an incubating fire.

Authors' contributions

APP and SP conceived and planned the experiments. APP, ISN, AL, FF conducted the clinical trial. IBS, GB, ALB and SP conducted the biological and molecular analysis. APP, IBS, ALB and SP, contributed to interpretation of the results. APP, IBS, ALB and SP wrote the manuscript. All authors provided critical feedback and helped shape the research manuscript.

Acknowledgements

The authors thank the Institut Français d’Indonésie (IFI) and the Institut National des Sciences Appliquées (INSA) de Lyon.

Availability of data and materials

All datasets can be requested upon reasonable request

Ethics approval and consent to participate

Competing interests

The authors declare that they have no competing interests

Funding

IBS was supported by a grant from Indonesian Ministry of Religious Affairs (MORA) Scholarship 5000 Doktor and supported by Kediri State Islamic Institute (IAIN) Indonesian Republic. APP was supported by a grant from the Directorate General of Research and Development Strengthening, the Ministry of Research, the Technology and Higher Education of The Republic of Indonesia (No:135/UN5.2.3.1/PPM/ KP-DRPM/2018) for conducting the field study. This study was supported by grant PHC NUSANTARA 2018 n° 38927UF from French Ministry of Europe and Foreign Affairs (MEAE) and French Ministry of Higher Education, Research and Innovation (MESRI).

Battle KE, Lucas TCD, Nguyen M, Howes RE, Nandi AK, Twohig KA, et al. Mapping the global endemicity and clinical burden of Plasmodium vivax, 2000-17: a spatial and temporal modelling study. Lancet Lond Engl. 2019;394:332–43.
Fahmi F, Pasaribu AP, Theodora M, Wangdi K. Spatial analysis to evaluate risk of malaria in Northern Sumatera, Indonesia. Malar J. 2022;21:241.
Howes RE, Battle KE, Mendis KN, Smith DL, Cibulskis RE, Baird JK, et al. Global Epidemiology of Plasmodium vivax. Am J Trop Med Hyg. 2016;95:15–34.
Bin Said I, Kouakou YI, Omorou R, Bienvenu A-L, Ahmed K, Culleton R, et al. Systematic review of Plasmodium knowlesi in Indonesia: a risk of emergence in the context of capital relocation to Borneo? Parasit Vectors. 2022;15:258.
Baird JK. Malaria zoonoses. Travel Med Infect Dis. 2009;7:269–77.
Buyon LE, Elsworth B, Duraisingh MT. The molecular basis of antimalarial drug resistance in Plasmodium vivax. Int J Parasitol Drugs Drug Resist. 2021;16:23–37.
Fryauff DJ, Baird JK, Candradikusuma D, Masbar S, Sutamihardja MA, Leksana B, et al. Survey of in vivo sensitivity to chloroquine by Plasmodium falciparum and P. vivax in Lombok, Indonesia. Am J Trop Med Hyg. 1997;56:241–4.
Price RN, von Seidlein L, Valecha N, Nosten F, Baird JK, White NJ. Global extent of chloroquine-resistant Plasmodium vivax: a systematic review and meta-analysis. Lancet Infect Dis. 2014;14:982–91.
World Health Organization. World malaria report 2021 [Internet]. [cited 2022 Mar 21]. Available from: https://www.who.int/publications/i/item/9789240040496
Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009;361:455–67.
Noedl H, Se Y, Schaecher K, Smith BL, Socheat D, Fukuda MM, et al. Evidence of artemisinin-resistant malaria in western Cambodia. N Engl J Med. 2008;359:2619–20.
Commons RJ, Simpson JA, Thriemer K, Abreha T, Adam I, Anstey NM, et al. The efficacy of dihydroartemisinin-piperaquine and artemether-lumefantrine with and without primaquine on Plasmodium vivax recurrence: A systematic review and individual patient data meta-analysis. PLoS Med. 2019;16:e1002928.
Flegg JA, Guerin PJ, White NJ, Stepniewska K. Standardizing the measurement of parasite clearance in falciparum malaria: the parasite clearance estimator. Malar J. 2011;10:339.
Hung T-Y, Davis TME, Ilett KF. Measurement of piperaquine in plasma by liquid chromatography with ultraviolet absorbance detection. J Chromatogr B Analyt Technol Biomed Life Sci. 2003;791:93–101.
Thuan PD, Ca NTN, Van Toi P, Nhien NTT, Thanh NV, Anh ND, et al. A Randomized Comparison of Chloroquine Versus Dihydroartemisinin-Piperaquine for the Treatment of Plasmodium vivax Infection in Vietnam. Am J Trop Med Hyg. 2016;94:879–85.
L’Episcopia M, Perrotti E, Severini F, Picot S, Severini C. An insight on drug resistance in Plasmodium vivax, a still neglected human malaria parasite. Ann Ist Super Sanita. 2020;56:409–18.
Picot S, Olliaro P, de Monbrison F, Bienvenu A-L, Price RN, Ringwald P. A systematic review and meta-analysis of evidence for correlation between molecular markers of parasite resistance and treatment outcome in falciparum malaria. Malar J. 2009;8:89.
Brega S, Meslin B, de Monbrison F, Severini C, Gradoni L, Udomsangpetch R, et al. Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity. J Infect Dis. 2005;191:272–7.
Barnadas C, Ratsimbasoa A, Tichit M, Bouchier C, Jahevitra M, Picot S, et al. Plasmodium vivax resistance to chloroquine in Madagascar: clinical efficacy and polymorphisms in pvmdr1 and pvcrt-o genes. Antimicrob Agents Chemother. 2008;52:4233–40.
Hailemeskel E, Menberu T, Shumie G, Behaksra S, Chali W, Keffale M, et al. Prevalence of Plasmodium falciparum Pfcrt and Pfmdr1 alleles in settings with different levels of Plasmodium vivax co-endemicity in Ethiopia. Int J Parasitol Drugs Drug Resist. 2019;11:8–12.
Marfurt J, de Monbrison F, Brega S, Barbollat L, Müller I, Sie A, et al. Molecular markers of in vivo Plasmodium vivax resistance to amodiaquine plus sulfadoxine-pyrimethamine: mutations in pvdhfr and pvmdr1. J Infect Dis. 2008;198:409–17.
Ngassa Mbenda HG, Wang M, Guo J, Siddiqui FA, Hu Y, Yang Z, et al. Evolution of the Plasmodium vivax multidrug resistance 1 gene in the Greater Mekong Subregion during malaria elimination. Parasit Vectors. 2020;13:67.
Tacoli C, Gai PP, Siegert K, Wedam J, Kulkarni SS, Rasalkar R, et al. Characterization of Plasmodium vivax pvmdr1 Polymorphisms in Isolates from Mangaluru, India. Am J Trop Med Hyg. 2019;101:416–7.
Villena FE, Maguiña JL, Santolalla ML, Pozo E, Salas CJ, Ampuero JS, et al. Molecular surveillance of the Plasmodium vivax multidrug resistance 1 gene in Peru between 2006 and 2015. Malar J. 2020;19:450.
Wang X, Ruan W, Zhou S, Feng X, Yan H, Huang F. Prevalence of molecular markers associated with drug resistance of Plasmodium vivax isolates in Western Yunnan Province, China. BMC Infect Dis. 2020;20:307.
Ferreira MU, Nobrega de Sousa T, Rangel GW, Johansen IC, Corder RM, Ladeia-Andrade S, et al. Monitoring Plasmodium vivax resistance to antimalarials: Persisting challenges and future directions. Int J Parasitol Drugs Drug Resist. 2021;15:9–24.
Li J, Zhang J, Li Q, Hu Y, Ruan Y, Tao Z, et al. Ex vivo susceptibilities of Plasmodium vivax isolates from the China-Myanmar border to antimalarial drugs and association with polymorphisms in Pvmdr1 and Pvcrt-o genes. PLoS Negl Trop Dis. 2020;14:e0008255.
Marfurt J, Wirjanata G, Prayoga P, Chalfein F, Leonardo L, Sebayang BF, et al. Longitudinal ex vivo and molecular trends of chloroquine and piperaquine activity against Plasmodium falciparum and P. vivax before and after introduction of artemisinin-based combination therapy in Papua, Indonesia. Int J Parasitol Drugs Drug Resist. 2021;17:46–56.
Popovici J, Kao S, Eal L, Bin S, Kim S, Ménard D. Reduced polymorphism in the Kelch propeller domain in Plasmodium vivax isolates from Cambodia. Antimicrob Agents Chemother. 2015;59:730–3.
Duanguppama J, Mathema VB, Tripura R, Day NPJ, Maxay M, Nguon C, et al. Polymorphisms in Pvkelch12 and gene amplification of Pvplasmepsin4 in Plasmodium vivax from Thailand, Lao PDR and Cambodia. Malar J. 2019;18:114.
Wang M, Siddiqui FA, Fan Q, Luo E, Cao Y, Cui L. Limited genetic diversity in the PvK12 Kelch protein in Plasmodium vivax isolates from Southeast Asia. Malar J. 2016;15:537.
Auburn S, Benavente ED, Miotto O, Pearson RD, Amato R, Grigg MJ, et al. Genomic analysis of a pre-elimination Malaysian Plasmodium vivax population reveals selective pressures and changing transmission dynamics. Nat Commun. 2018;9:2585.
de Monbrison F, Angei C, Staal A, Kaiser K, Picot S. Simultaneous identification of the four human Plasmodium species and quantification of Plasmodium DNA load in human blood by real-time polymerase chain reaction. Trans R Soc Trop Med Hyg. 2003;97:387–90.
Imwong M, Pukrittayakamee S, Grüner AC, Rénia L, Letourneur F, Looareesuwan S, et al. Practical PCR genotyping protocols for Plasmodium vivax using Pvcs and Pvmsp1. Malar J. 2005;4:20.
Saidi AM, Guenther G, Izem R, Chen X, Seydel K, Postels D. Plasmodium falciparum clearance time in Malawian children with cerebral malaria: a retrospective cohort study. Malar J. 2021;20:408.
Medicines for Malaria Venture, Organization WH. Methods and techniques for clinical trials on antimalarial drug efficacy : genotyping to identify parasite populations : informal consultation organized by the Medicines for Malaria Venture and cosponsored by the World Health Organization, 29-31 May 2007, Amsterdam, The Netherlands [Internet]. World Health Organization; 2008. Available from: https://apps.who.int/iris/handle/10665/43824

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Prospective observational study of dihydroartemisinin-piperaquine treatment of vivax malaria in North Sumatera, Indonesia

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1