Experimental animals
Four-week-old C57BL/6 mice were purchased from Chongqing Tengxin Biotechnology Co., Ltd (Chongqing, China). All animal procedures were reviewed and approved by the Ethics Committee of Southwest Medical University (20180391222). The weight of each mouse at the time of purchase was approximately 18 g. Mice have free access to drinking water and food. They were acclimatized for 1 month at a suitable temperature and humidity, and used in experiments when their weight was approximately 25–28 g.
Experimental Methods
Isolation and culture of mouse ASCs
Subcutaneous fat was harvested from the inguinal region in mice and sequentially treated with PBS containing 10% penicillin-streptomycin (Hyclone, Pittsburgh, USA), 5% penicillin-streptomycin in PBS, and PBS without penicillin-streptomycin to remove blood and hair from the tissue mass. The adipose tissue was cut into approximately 1 mm3 fragments and evenly inoculated into USA25-cm2 culture flasks, each containing 4 mL modified Eagle’ s medium (Hyclone, Pittsburgh, USA) with 10% fetal bovine serum (Schaumburg, Pittsburgh, USA) to completely submerge the tissue blocks, followed by incubation at 37°C with 5% CO2 for 7 days. The medium was changed every 2 days. At 80% confluence, the cells were sub-cultured, and third passage cells were used in experiments.
Characterization Of Ascs By Flow Cytometry
Passage 3 mouse ASCs were digested with 0.25% trypsin-EDTA (Gibco, New York, USA) washed three times with PBS (1000 r, 5 min), resuspended in pre-cooled PBS, and then stained with the fluorescent dye-conjugated antibodies against CD29, CD44, CD90, CD31, CD34 and CD45. An unstained sample was used as the blank control. Cells were analyzed by a flow cytometer (MoFloAstrios EQs, BECKMAN, Bria, CA, USA).
Cell Viability And Proliferation Assay
The effects of AGEs (BIOVISION, San Francisco, CA, USA), 3-methyladenine (3-MA; autophagy inhibitor, MCE), rapamycin (Rapa; autophagy agonist, MCE) on ASCs viability and proliferation were assessed and the optimal concentration was selected. Passage 3 ASCs were seeded in 96-well plates (4×103 cells per well), cultured for 24 hours, then treated with various concentrations of AGEs (20, 40, 60, 80, and 100 µg/mL) for 1, 4, and 7 days, 3-MA (1, 2, 3, 4, 5, 6, 7 mmol/L) for 1–3 days, or Rapa (2, 4, 6, 8, 10, 12, and 1 4 nmol/L) for 1, 2, and 3 days. Cell viability was assessed by CCK-8 assays. After treatment, the cells were carefully rinsed with PBS and 100 µL medium containing 10 µL CCK-8 solution was applied at 37°C for 2 hours. Optical density was measured at 450 nm using a Spectra Max M3 microplate spectrophotometer (Spectra Thermo, Switzerland). Optical density values are expressed as the average of three wells for each group. The percentage of treated cells relative to control cells was calculated as cell viability. Each experiment was repeated three times.
Western Blot Analysis
Western blotting was used to measure LC3-II/LC3-I, SQSTM1, RUNX2, and OPN levels. Treated cells were washed with PBS, and total protein was isolated from the cells using a total protein extraction kit (KEYGEN Biotech, Nanjing, China). Protein samples were mixed with loading buffer at 4:1, boiled for 10 minutes, separated by SDS-PAGE, transferred to a polyvinylidene fluoride membrane, blocked in 5% dry skim milk in Tris buffered saline with 0.05% (V/V) Tween-20 (TBST) for 1 hours, and then incubated with antibodies against GAPDH (cst5174S), LC3 (cst12741S), SQSTM1 (ab195352), RUNX2 (ab92336), or OPN (ab63856) (Abcam, Cambridge, UK) overnight at 4°C. The membrane was washed with TBST three times and then incubated with a secondary labeled anti-rabbit antibody (1:3000) for 1 h. The membrane was then washed with TBST three times and protein levels were determined using an enhanced chemiluminescence detection system (Bio-Rad, Hercules, CA, USA).
Quantitative Polymerase Chain Reaction
Quantitative polymerase chain reaction (qPCR) was used to measure mRNA expression of autophagy- and osteogenesis-related genes Lc3, Sqstm1, Runx2, and Opn in mouse ASCs after osteogenic induction. Total RNA was isolated using a total RNA extraction kit (Tiangen, Shanghai, China). A Revert Aid First Strand cDNA synthesis kit (Thermo, Waltham, MA, USA) was used for reverse transcription into cDNA. All primers were synthesized by Sheng Gong Bioengineering Company. The specific primer sequences were as follows. Lc3: TTATAGAGCGATACAAGGGGGA (forward) and CGCCGTCTGATTATCTTGATGAG (reverse); Sqstm1: AGGAGGAGACGATGACTGGACA (forward) and TTGGTCTGTAGGAGCCTGGTGAG (reverse); Runx2: TCCCGTCACCTCCATCCTCTTTC (forward) and GAATACGCATCACAACAGCCACA (reverse); Opn: ATGGACGACGATGATGACGATGATG (forward) and CTTGTGTACTAGCAGTGACGGTC (reverse). qPCR was performed using a Prime Script RT-PCR test kit (Takara Bio, Tokyo, Japan) in a 7900 System with SDS software. Amplification and dissolution curves were determined and relative expression of target genes was calculated and statistically analyzed.
Alkaline Phosphatase (Alp) Staining
Alkaline phosphatase activity in ASCs was analyzed by alkaline phosphatase staining after treatment of ASCs with osteogenic induction medium (Cyagen, Guangzhou, China) containing AGEs, 3-MA, or Rapa. ASCs were seeded in 12-well plates at approximately 5×104 cells per well, and the medium was changed to osteogenic induction medium containing AGEs, 3-MA, or Rapa. The medium was changed after 3 days. After 3 and 5 days of osteogenic induction, the osteogenic induction medium was removed, and the cells were washed twice with PBS and then fixed with 4% paraformaldehyde for 30 min at 4°C. The cells were stained using an alkaline phosphatase assay kit (Beyotime, Shanghai, China), in accordance with the manufacturer’s instructions to detect alkaline phosphatase activity.
Alizarin Red Staining
After incubation in osteogenic induction medium containing AGEs, 3-MA, or Rapa for 21 days, ASCs were washed twice with PBS and fixed at 4°C for 30 minutes. The cells were then stained with a 0.1% alizarin red solution at 37°C for 30 minutes to assess calcium nodule formation. Images were acquired with a camera (Canon, Tokyo, Japan).
Immunofluorescence Staining
Immunofluorescence was used to detect the expression of osteogenesis-related proteins RUNX2 and OPN after treatment with osteogenic induction medium containing AGEs, 3-MA, or Rapa. ASCs were seeded in a confocal culture dish at approximately 5×104 cells per dish. The cells were treated with osteogenic induction medium containing AGEs, 3-MA, or Rapa for 3 days. The cells were then fixed with 4% paraformaldehyde at 4°C for 30 minutes, treated with 0.5% Triton X-100 for 10 minutes to permeabilize the cell membrane, incubated with 5% goat serum for 1.5 hours, and then incubated with a primary antibody (1:100 dilution) against RUNX2 or OPN overnight at 4°C. The following day, the cells were rewarmed at room temperature for 30 min and then incubated with a fluorochrome-conjugated anti-rabbit secondary antibody (1:200, Invitrogen, CA, USA) for 1 h at 37°C. The cytoskeleton and nuclei of cells were stained by incubation with FITC for 30 min and DAPI for 15 min, respectively. Cells were washed three times with PBS for 5 min between each step. Finally, images were obtained under a laser confocal microscope (Leica, Wetzlar, Germany).
Statistical analysis
Statistical analysis was conducted in SPSS 19.0 software. All experiments were repeated at least three times. The reliability of the experimental data was assessed by the t-test or one-way analysis of variance. Results are expressed as the mean ± standard deviation (SD).