Cell culture. Human myeloid leukemia mononuclear cells THP-1 and mouse macrophage-like (RAW 264.7) cell were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). THP-1 cells were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Ausbian, USA) and 1% penicillin/streptomycin (Solarbio, China). RAW 264.7 cells were cultured in full DMEM (Gibco, USA) containing 10% FBS. Culturing was done at 37°C and 5% CO2 in a constant temperature and humidity incubator.
BCG culture and infection. Bacillus Calmette-Guérin (BCG) was purchased from the Chinese Centre for Disease Control and Prevention (Beijing, China). Cultures were grown in Middlebrooks 7H9 broth (Becton Dickinson & Company, USA) containing 0.5% glycerol, 0.05% Tween-80 and 10% OADC. Cultures were incubated in a constant temperature incubator at 37°C, and the cells were collected by centrifugation when the culture had reached the appropriate density (OD600 = 0.5). Prior to infection, THP-1 cells grown to log phase were seeded into six-well plates with 1 × 106 cells per well. THP-1 cells were cultured for 24 h in medium containing 50 ng/mL PMA (Sigma-Aldrich, USA), which was used to induce THP-1 monocyte differentiation into macrophages. Adherent cells were then infected with BCG at an MOI of 10.
Construction and transfection of DUSP1 small interfering RNAs. Three small interfering RNA sequences (Table 1) were designed against the sequence of the human DUSP1 coding region and synthesized by Genepharma (Shanghai, China). THP-1 cells were induced in a 6-well plate using PMA, seeded at a density of 1 × 106cells per well before transfection with the small interfering RNA. Transfections were performed using Lipofectamine™ RNAi MAX reagent (Invitrogen, USA) according to the manufacturer's protocol and the fluorescence intensity was observed by fluorescence microscopy 24 h post-transfection.
siRNA
|
Sense(5’-3’)
|
Antisense(5’-3’)
|
Table 1
The sequence of small interfere RNA
#1
|
GCUCCUUCUUCGCUUUCAATT
|
UUGAAAGCGAAGAAGGAGCTT
|
#2
|
CUCCCAACUUCAGCUUCAUTT
|
AUGAAGCUGAAGUUGGGAGTT
|
#3
|
CGAGGCCAUUGACUUCAUATT
|
UAUGAAGUCAAUGGCCUCGTT
|
NC
|
UUCUCCGAACGUGUCACGUTT
|
ACGUGACACGUUCGGAGAATT
|
RNA isolation and real-time PCR. Total RNA was extracted from THP-1 cells using the Total RNA Extraction Kit (TIANGEN, China) following the manufacturer's protocol. The first strand was synthesized from 1 µg of total RNA using the Reverse Transcription System Kit (Takara, China) and RT-qPCR was performed using SYBR Premix ExTaq II (Takara, China) in a total volume of 20 µL. Sequences of primers using in RT-qPCR are listed in Table 2. Expression levels are normalized to GAPDH, with each assay performed in triplicate. Relative fold changes in messenger RNA expression were calculated using the 2−ΔΔCt method.
Western Blotting. Total protein was extracted from THP-1 cells using a total protein extraction kit (KeyGEN BioTECH, China), following which cell lysate was spun at 12000 rpm. The supernatant was then collected and protein concentration was determined via BCA assay (ThermoFisher, USA). The protein samples were then heated at 100 ℃ in 1× protein loading buffer (Transgene, China) for 5 min and separated via 10% SDS-PAGE. Blots were then wet transferred to PVDF membranes, blocked with 5% skimmed milk for 1 h at room temperature and phosphorylated antibodies were blocked with 3% BSA. Samples were then incubated overnight after addition of detection antibodies at the following dilution factor: DUSP1 (1:1000); ERK (1:1000); p-ERK (1:1000); p-NF-κB p65 (1:1000; all from Affinity, China); Bcl-2 (1:2000); Bax (1:2000); Cytochrome C (1:1000); Apaf-1 (1:1000); Cleaved-PARP1 (1:2000); Cleaved-caspase3 (1:2000); Cleaved-caspase9 (1:1000; all from Abcam, UK); p38 (1:1000); p-p38 (1:1000); JNK (1:1000); p-JNK (1:1000; all from ABclonal, China); and GAPDH (1:2000; Abmart, China). Membranes were then incubated with horseradish peroxidase (HRP)-coupled IgG for 1 h at room temperature (1:5000; Abmart, China). After washing with TBST, immunoreactive bands were observed using the ECL kit (Advansta Inc., USA) and scanned for protein bands using Amersham ImageQuant 800 (Cytiva, Japan). Finally, protein bands were then quantified using ImageJ software.
Detection of apoptosis by flow cytometry. THP-1 cells (1 × 106 cells/well) were seeded in 6-well plates, transfected with siRNA-DUSP1, incubated for 24 h, and infected with BCG (MOI = 10) and incubated for another 6 h. Apoptosis was adetected by FACS using an Annexin V/propidium iodide (PI) kit (KeyGEN BioTECH, China). Cells were then harvested and washed twice with PBS, then resuspended in 500 µL binding buffer. 5 µL of Annexin V staining solution and PI staining solution were added to each sample and incubated for 15 min at room temperature protected from light. After centrifugation at 1000 rpm for 5 min, the cell pellets were resuspended in 500 µL binding buffer and the samples were analyzed at 535 nm (PI) and 488 nm (Annexin V) using a FACS Canto™ II cytometer (BD, USA).
Immunofluorescence assay. THP-1 cells (1×105 cells/well) were seeded in 12-well plates with cell coverslips, transfected with siRNA-DUSP1, and cultured for 24 h post-transfection. Cells were infected with BCG (MOI = 10) and incubated for another 6 h. The cells were then washed 3 times with PBS and fixed with 4% paraformaldehyde for 20 min. The cells were washed and permeabilized with 0.5% TritonX-100 for 20 min, then blocked with 3% BSA for 1 hour at room temperature. Antibodies were diluted in 3% BSA at dilution factors of DUSP1 (1:200), Cleaved-Caspase3 (1:200), Cleaved-PARP1 (1:200), p-p38 (1:100), p-JNK (1:100), p-ERK (1:200), and p-NF-κB p65 (1:200). 500 µL of the primary antibody was added to each well and incubated overnight at 4°C. After washing three times with PBS, cells were incubated with fluorescein-coupled secondary antibody (1:1000) in PBS for 1 h at 37°C, protected from light. Finally, cells were stained with a fluorescent blocker containing DAPI (ORIGENE, China) blocked, and images were acquired with a Leica TCS SP2 A0BS confocal system and processed on Leica confocal software (Leica, Germany).
Enzyme-linked immunosorbent assay. The ELISA kits for IL-1β and TNF-α were obtained from Thrive Biotechnology (Shanghai, China). Peripheral blood was collected from mice in different treatment groups and the levels of inflammatory cytokines TNF-α and IL-1β were measured by ELISA. The experiments were performed according to the manufacturer's instructions, and the experiments were repeated three times and the mean values were taken.
Transmission electron microscopy. THP-1 cells were washed with PBS, fixed with 3% glutaraldehyde, refixed with 1% osmium tetroxide, dehydrated step by step in acetone, and embedded using Ep812 (EMCN, China). Ultra-thin sections were then made with a diamond knife, sections were stained with uranyl acetate (EMCN, China) and lead citrate (EMCN, China) and observed by JEM-1400FLASH transmission electron microscopy (JEOL, Japan).
Animal experiments. C57BL/6J mice were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. (Chengdu, China). The mice were housed in a special pathogen-free room with food and water ad libitum and regular 12:12 light–dark cycle. Three siRNAs targeting mouse DUSP1 (Table 3) were transfected into RAW264.7 cells using Lipofectamine™ RNAi MAX Reagent (Invitrogen, USA) according to the manufacturer's protocol to screen for the best siRNA-DUSP1. In vivo experiments were performed using Advanced Transfection Reagent (ZETA, USA) to interfere with lung DUSP1 expression in C57BL/6J mice by multiple airway infusions. 24 male C57BL/6J mice (8 weeks old) were used for in vivo experiments. The mice were weighed and recorded before drug treatment. BCG was diluted to 2×106 CFU/100 µL suspension using saline. siRNA-DUSP1 was prepared to 1 OD/50 µL using nuclease-free water, siRNA-DUSP1 was prepared to 20 µg/100 µL working solution using saline, and saline solution alone was used as a negative control (100 µL). Either diluted BCG suspension or saline was administered into the airways of mice. siRNA-DUSP1 working solution was administered one day after BCG infection, and mice were treated every 6 days. Mice (6 per group) were sacrificed on day 21, and the concentrations of TNF-α and IL-1β in peripheral blood were determined at terminal timepoint using ELISA. Lung tissues were collected, fixed and stained with haematoxylin and eosin (H&E) as previously described, before performing immunohistochemical analysis, imaging of the sections using a microscopic camera system, and calculation of the percentage of positive area per image using the Halo data analysis system.
Table 2 Gene specific primers for RT-qPCR
Gene
|
Primers
|
Primers sequence(5’-3’)
|
GAPDH
|
Forward
Reverse
|
TGACATCAAGAAGGTGGTGAAGCAG
GTGTCGCTGTTGAAGTCAGAGGAG
|
DUSP1
TNF-α
IL-1β
|
Forward
Reverse
Forward
Reverse
Forward
Reverse
|
ACAACCACAAGGCAGACATCAGC
CCTCATAAGGTAAGCAAGGCAGATGG
CAATGGCGTGGAGCTGAGAGATAAC
TTGAAGAGGACCTGGGAGTAGATGAG
TGATGGCTTATTACAGTGGCAATGAGG
TGTAGTGGTGGTCGGAGATTCGTAG
|
Table 3
The sequence of small interfere RNA
siRNA
|
Sense(5’-3’)
|
Antisense(5’-3’)
|
&1
|
GUGCCCUGAACUACCUUAATT
|
UUAAGGUAGUUCAGGGCACTT
|
&2
|
CCACUCAAGUCUUCUUUCUTT
|
AGAAAGAAGACUUGAGUGGTT
|
&3
|
GCUCCUUCUUCGCUUUCAATT
|
UUGAAAGCGAAGAAGGAGCTT
|
NC
|
UUCUCCGAACGUGUCACGUTT
|
ACGUGACACGUUCGGAGAATT
|
Ethics statements. This study was carried out with the approval of the Research Ethics Committee of the Institutional Animal Care and Use Committee of Ethics Committee of Sichuan Lilaisinuo, under protocol number LLSN-2022002. All research was performed in accordance with relevant guidelines and regulations.
Statistical analysis. Statistical tests were conducted with GraphPad Prism v8.0 (GraphPad Software, USA). All results were described as mean ± SD and were derived from 3 biological replicates. The difference between the 2 groups was compared by one-way ANOVA.