Screening co-expressed target genes in rats and goats of blast lung injury through comparative transcriptomic analysis

doi:10.21203/rs.3.rs-2206119/v1

Download PDF

Research Article

Screening co-expressed target genes in rats and goats of blast lung injury through comparative transcriptomic analysis

https://doi.org/10.21203/rs.3.rs-2206119/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Blast lung injury (BLI) has been one of the most threat for human beings with the frequent occurrence of local wars, terrorist attacks and industrial explosions. The underlying mechanisms remains unclear. In this paper, transcriptome sequencing was performed in the lung tissues of the two species of goat and rat to identify the potential therapeutic targets involved in BLI.

Results

In this paper, the BLI models of rat and goat were successfully by validated HE-stain. Reddish edema fluid, erythrocyte, and even focal or patchy bleeding occurred in the alveolar cavity were visible under microscope. The genomic information of the two species was obtained by transcriptome sequencing. There were 83 DEGs co-expressed in rats and goats, among which 49 genes showed the same expression trend, including 38 up-regulated expression genes and 11 down-regulated expression genes. By the enrichment analysis, IL-17 signaling pathway and vascular smooth muscle contraction pathway are involved in BLI mechanism. The genes expressed in lung were screened for experimental verification, the main genes associated with BLI in both goat and rat are AGR2, ANKRD65, BPIFA1, BPIFB1 and KRT4.

Conclusion

In this study, the whole genomes of two species of BLI models were sequenced to dissect the basic characteristics of their genomes, laying the foundation for further investigation the mechanisms of BLI. By the genomic analysis, the expressed genes were involved in IL-17 signaling pathway and vascular smooth muscle contraction pathway associated with BLI. Finally, AGR2, ANKRD65, BPIFA1, BPIFB1 and KRT4 were highly expressed in both goat and rat BLI model, which could be used as potential target genes and may serve as biomarkers for the prognosis, diagnosis and therapy for BLI.

target genes

blast lung injury

transcriptomic

differentially expressed genes

In recent years, with the frequent occurrence and increasingly serious social harm of various local wars, terrorist attacks, industrial explosions, blast lung injury(BLI) has been widely concerned by the whole society[1–3]. It is defined as “the damage to the lung parenchyma and associated vasculature resulting from pressure differentials in the initial blast wave, which is a kind of acute lung injury within 12 hours of blast exposure and is not due to penetrating or blunt injury[2]. Lung is one of the most sensitive target organs of the body to the blast shock wave. Because of its serious condition, rapid development, difficult treatment and high mortality, BLI has been a research topic widely concerned in the military medical field. Numerous clinical studies revealed that BLI could lead to serious symptoms as acute lung injury (ALI), acute respiratory distress syndrome (ARDS), multiple organ dysfunction syndrome (MODS), or even fatality in the short terms[4–6]. Unfortunately, it is challenging to discover the possible causes of lung injury caused by shock waves, and it is likely to call for cutting-edge approaches to understand the underlying mechanisms. Therefore, there is an urgent need to carry out research on the effects, mechanisms and protection of BLI.

Previous studies have reported some researches on the target genes of BLI. Clara cell secretory protein 16 (CC16) is considered to be a biomarker related to the lung epithelial integrity which can be utilized as a sign of either direct or indirect lung injury[7, 8]. Leukotriene B4 (LTB-4) is a strong chemoattractant and an inducer of neutrophil adhesion to endothelial cells, which expression level has a strong correlation with non-traumatic lung injury and prognosis. High serum concentration of LTB-4 can identify the high risk of pulmonary complications in patients with severe injury, while the specificity was 71% and the sensitivity was 67%[9]. von Willebrand factor (VWF), a macromolecular antigen created by endothelial cells and included in hemostasis, has been broadly examined in patients with ARDS and high-risk patients, showing a correlation between lifted serum levels and destitute prognosis[10]. Angiopoietin-2 (Angiopoietin-2) can induce vascular infiltration and result in endothelial junction instability and vascular leakage. The hoisted plasma Ang-2 level is correlated with the occurrence of acute respiratory distress syndrome, and can be used to distinguish early onset and late onset ARDS patients[11]. To differentiate trauma patients with ALI and ARDS from those without, Fremont et al. [12] demonstrated the use of a biomarker combination (RAGE, PCPIII, BNP, Ang2, IL-10, TNF-α and IL-8) as a diagnostic tool. LC3B-II, Beclin 1, P62, HIF1/BNIP3 and mTOR play a critical role in autophagy induction in lung injury which can be used as theoretical guidelines for the development of protective measures against lung injury[13]. Andrew et al. [14] collected blast injury cases and found that neutrophil gelatinase-associated lipocalin (NGAL) expression was negatively correlated with oxygenation index, which can be used as a biomarker for BLI diagnosis. These metabolites were used as circulating biomarkers to explore the potential mechanism of BLI.

Currently, none of the markers analyzed alone or in combination have sufficient specificity and sensitivity to be used as a primary diagnostic tool for BLI. With the development of life science and technology, the application of genomics, proteomics and metabolomics to search and discover valuable target genes in clinical patients' body fluids or tissues has become an important research hotspot[15]. As RNA sequencing (RNA-seq )has become widely used in the mechanism of injury research, it is becoming an important component of elucidating the molecular mechanism of chemical and physical lung or chemical induced lung injury[16, 17]. Cross-species transcriptome comparisons not only help us understand the evolution of biological systems and infer gene functions, but also reveal the underlying mechanisms of diseases[18, 19]. The rapid development of multi-species next-generation high-throughput sequencing data has accelerated the research process of cross-species comparison in exploring the occurrence, development, diagnosis, treatment, rehabilitation and prognosis of diseases.

Contributed to the fact that the goats’ lung structure and rats’ gens are similar to human beings, in this study, we selected two species of goat and rat models based on actual combat environment by transcriptome sequencing. The differentially expressed genes (DEGs) of goat and rat lungs exposed to shock wave were identified while functional annotation and KEGG enrichment of the DEGs were performed. Furthermore, q-PCR and ELISA was implemented to verify the RNA-seq results. This study aims to find target genes so as to seek new ideas for assessment, diagnosis, treatment and rehabilitation intervention of BLI

The histopathology of rat and goat lung exposed to shock waves

As shown in Fig. 1, compared with the control group, there were significant pulmonary hemorrhage in the rat and goat lungs of the experimental group under microscope. Notably, reddish edema fluid, erythrocyte, and even focal or patchy bleeding occurred in the alveolar cavity. These results suggested that the BLI model was successful and the injury effect was evident.

The quality of RNA-seq data in lung tissue of BLI goats and rats

The quality of goat and rat lung tissue sequencing data (Table 1, Table 2) was analyzed. After filtering the low-quality sequences, the Q30 (the proportion of the number of bases in the total sequence with a quality value of more than 30 and an error rate of less than 0.1%) of each sample exceeded 90%, and the higher the value, the better the sequencing quality. HISAT2 (Version2.1.0) was used to match clean data, and the comparison rate of all samples was above 90%.

Table 1

The quality of RNA-Seq data in the lung of BLI goats.
Sample	C1	C2	C3	T1	T2	T3
Raw reads	45397848	49030928	46502,552	47276996	48213416	49043910
Clean reads	42956812	46805200	44444718	45851248	46560438	46745492
Q30 (%)	93.92	94.06	93.83	93.91	94.08	94.12
Total- mapped	41654953 (96.97%)	45403546 (97.01%)	43042554 (96.85%)	44465804 (96.98%)	45142364 (96.95%)	45335591 (96.98%)
Uniquely-mapped	40113769 (96.30%)	43728229 (96.31%)	41463802 (96.33%)	42827550 (96.32%)	43460062 (96.27%)	43573934 (96.11%)

Table 2

The quality of RNA-Seq data in the lung of BLI rats.
Sample	C1	C2	C3	C4	C5	T1	T2	T3	T4	T5
Raw reads	50584318	48903666	47995724	47615894	49799294	47259746	50348742	50130624	49631258	47451972
Clean reads	46130700	45036240	45384650	44083162	46991070	44323250	47991598	47038614	46289260	45304886
Q30 (%)	92.17	93.50	93.75	93.64	93.44	93.60	93.72	93.69	93.12	93.85
Total- mapped	42269007 (95.37%)	45851624 (95.54%)	44895363 (95.44%)	44090571 (95.25%)	43291370 (95.56%)	43608857 (94.53%)	42884844 (95.22%)	43300335 (95.41%)	42042563 (95.37%)	44697808 (95.12%)
Uniquely- mapped	39569373 (93.91%)	43025311 (94.11%)	42113145 (94.09%)	41385071 (94.16%)	40653152 (94.18%)	40682021 (93.66%)	40079657 (93.77%)	40467003 (93.76%)	38950438 (92.99%)	41820313 (93.88%)

Co-expressed DEGs for BLI goats and rats

The DEGs were identified using the criteria of q ≤ 0.05 and |log₂ fold change | ≥ 1. Sequencing data analysis revealed that 895 goat DEGs were screened out, of which 516 showed up-regulation and 379 showed down-regulation (Fig. 2A). A total of 1321 DEGs were screened out in rats, among which 806 were up-regulated and 515 were down-regulated (Fig. 2B). There were 83 differentially expressed genes co-expressed by rats and goats (Fig. 2C), 49 of which showed the same expression trend, with 38 genes up-regulated and 11 genes down-regulated (Fig. 2D and Fig. 2E). In the meantime, Pearson correlation was used to evaluate the Log₂ fold change values of 49 genes co-expressed in goat and rat. The results showed demonstrated that the expression levels of common genes were positively correlated between the two species (r = 0.742, P < 0.000).

GO enrichment analysis of DEGs in BLI goats and rats

GO enrichment analysis showed (Fig. 3A) that DEGs of goat lung tissue enriched 52 GO categories (q < 0.05), involving 17 "cellular components", 23 "biological processes" and 12 "molecular functions". The DEGs of rat lung tissue enriched 51 GO categories (q < 0.05), involving 15 "cellular components", 23 "biological processes" and 13 "molecular functions"(Fig. 3B). The 49 overlapping gene co-expressed in goat and rat were annotated and categorized as Fig. 3C. The results showed the top three enrichment in biological process, cellular component and molecular function were signal transduction, extracellular space and epidermal growth factor receptor binding, respectively. The signal transduction was enriched in 6 genes in biological process, accounting for 12.5%. The extracellular space was enriched in 14 genes in cellular component, accounting for 29.17%. The epidermal growth factor receptor binding was enriched in 3 genes in molecular function, accounting for 6.25%.

KEGG pathway enrichment analysis of DEGs in BLI goats and rats

To further elucidate their molecular and biological functions, KEGG pathway enrichment analysis was conducted based on differential epigenetic patterns. It was found that goat DEGs were involved in 256 pathways, of which 26 pathways were significantly enriched (q < 0.05)( Fig. 4A). The rats showed that 287 pathways were associated with rats DEGs, and 12 were significantly enriched (Fig. 4B). Of all the enriched pathways, IL-17 signaling pathway was significantly enriched in both goat and rat species. These results suggest that IL-17 signaling pathway may play an important role in the molecular mechanism of blast shock wave lung injury, which provides important clues for future molecular mechanism studies.

The validation of DEG expression by q-PCR

We conducted an information query in the National Library of Medicine (NIH) Gene database for 49 genes co-expressed in goat and rat. The restricted expression toward and biased expression genes in the lung were selected as target genes. The results showed that BPIFA1, BPIFB1 and KRT4 were restricted expressed while AGR2, ANKRD65, RIN1 and FREM1 were biased expressed in the lung. In order to verify the consistency of gene expression, these genes were validated by q-PCR in rats lung tissue as target genes. Among them, AGR2, ANKRD65, BPIFA1, BPIFB1, KRT4 and RIN1 were up-regulated, while FREM1 was down-regulated (Fig. 5).

The validation of DEG expression by ELISA

On the basis of q-PCR verification, ELISA kit was used to detect the expression of AGR2, ANKRD65, BPIFA1, BPIFB1, KRT4 and RIN1 proteins in serum of rats with severe blast lung injury. Compared with the control group, except RIN1, the other five proteins were significantly increased, and the differences were statistically significant (P < 0.001) as shown in Fig. 6. The findings demonstrated that the expression of these proteins in serum could be used as potential target genes for BLI.

Distribution of target genes in the lung cells

We consulted the relevant databases of these potential target genes and analyzed their sorting of purified subpopulations through the gene website (https://www.proteinatlas.org/). As shown in Fig. 7, BPIFA1 is expressed in alveolar epithelial cells, bronchial epithelial cells and club cells. AGR2 is expressed in both of club cells and undifferentiated cells. BPIFB1, ANKRD65 and KRT4 are expressed in club cells, respiratory ciliated cells and squamous epithelial cells, respectively. These results indicated that the differently expressed genes were involved in epithelial cells, club cells, respiratory ciliated cells and undifferentiated cells.

BLI model establishment and verification

Animal model is one of the mainstream research methods of blast injury. In the study, the animals of goat and rat selection were mainly based on the following principles: Firstly, the principle of similarity in the structure, function anatomical characteristics and damage threshold of animal’s are similar to those of humans. Secondly, the principle of accessibility is based on standard animals or local general breeds at the testing site. Thirdly, the principle of homogeneity considers the same strain and individuals age, weight difference is no more than 20%. Therefore, two species of goat and rat were selected to represent large and small animals, respectively. The transcriptome sequencing was conducted to identify and analyze the common differentially expressed genes(DEGs) and of goat and rat with blast lung injury caused by explosion shock wave. Meanwhile, q-PCR and ELISA were used to verify some key genes, which will provide support for the mechanism, marker screening and prognostic intervention of blast lung injury.

RNA sequencing and potential target gene screening

With the development of high-throughput sequencing technologies, BLI target gene screening through associated gene networks, data selection and functional annotation become possible. In this study, the HiSeq Xten platform was used for the RNA sequencing of goat and rat lung tissue. To ensure the accuracy of the results, the processes of lung tissue sampling, RNA extraction, library construction, sequencing and analysis were strictly carried out according to operating instruction. After filtering the low-quality sequences, the Q30 of each sample was more than 90% which represented the sequencing quality was perfect. HISAT2 (Version2.1.0) with the threshold that is, the differential expression ratio was 2, the p-value and the q-value was 0.05[20]. The sequencing data analysis results show that there was 895 DEGs were screened out in BLI lung of goats, including 516 up-regulated and 379 down-regulated genes. Meanwhile, here was 1321 DEGs were screened out in BLI lung of rats, among which 806 genes were up-regulated and 515 genes down-regulated. There were 89 DEGs in two species of rat and goat, 49 genes of which showed the same expression trend, including 38 up-regulated genes and 11 down-regulated genes. At the same time, the Log₂ fold change values of 49 genes co-expressed in goat and rat were analyzed by Pearson correlation analysis. The outcomes demonstrated a positive correlation between the expression levels of co-expressed genes in the two species.

For the purpose of verifying the consistency of gene expression, we selected the restricted expression toward (BPIFA1, BPIFB1, KRT4) and biased expression genes in the lung (AGR2, ANKRD65, RIN1, FREM1) were validated by q-PCR. The results showed that AGR2, ANKRD65, BPIFA1, BPIFB1, KRT4 and RIN1 were up-regulated, while FREM1 was down-regulated, which was consistent with the expression trend of sequencing data. BPIFA1 and BPIFB1 with immunomodulatory activities, which may increase the severity of cystic pulmonary fibrosis if they were highly expressed in lung tissue[21]. Britto et al.[22] demonstrated that BPIFA1 is an abundant airway host protection protein by affecting interferon-γ signaling and IFN-induced cytokine CXCL10 in the regulation of neutrophil (PMN) aggregation to the lung and regulating the inflammatory response. More and more literature has reported BPIFB1 can also be used to diagnose autoimmune lung interstitial diseases[23,24]. Furthermore, BPIFA1 and BPIFB1 are also involved in the pathogenesis of COPD. Smet et al. [25] found that the mRNA expression of BPIFA1 and BPIFB1 in stage III-IV COPD patients was significantly higher than that in stage II and non-COPD patients, and the expression levels were negatively correlated with the measurement of airflow limitation, and positively correlated with goblet cell hyperplasia. Gao et al.[26] found that BPIFB1 in sputum was highly expressed in COPD patients with smoking history, which was related to the change of lung function over time and may be involved in the pathogenesis of smoking-related lung diseases. Li et al. [27] reported that BPIFB1 is considered an innate immune molecule and plays a critical role in the recognition and response of Gram-negative bacteria by promoting innate immunity through its structural similarity with BPI protein and lipopolysaccharide binding protein. In conclusion, BPIFA1 and BPIFB1 may play an important role in the mechanism of blast lung injury.

Keratin 4 (KRT4) is expressed as a member of the keratin gene family in stratiform epithelial tissues and consists of basic or neutral proteins constituting type II cytokeratin chains. Sakamoto et al.[28] reported that KRT4 and KRT13 are major differentiation-related keratins in oral keratinocytes, but their abnormal expression indicates dysregulated epithelial differentiation in oral squamous cell carcinoma and oral epithelial dysplasia, which may be helpful for pathological diagnosis. Zhang et al. [29] found that KRT4 gene mutation contributes to the key role of the organization in the pathogenesis of human white sponge nevus. Kanazawa et al. [30] found a missense mutation in exon 1A of KRT4 gene was associated with the occurrence of white sponge nevus, which was suggested that genetic analysis should be performed for the diagnosis of the disease. At the same time, it was found that the disease temporarily subsided after oral amoxicillin 750 mg/ day treatment, indicating that antibiotics were effective in symptomatic cases. Anterior Gradient 2 (AGR2), as a new oncogenic factor, has been found to be involved in a series of expressions in asthma, inflammatory bowel disease, cell transformation, cancer drug resistance and metastatic growth, particularly highly expressed in tumors. The deletion of AGR2 gene will reduce the survival cycle process of cells and lead to apoptosis. Narumi et al. [31] found that AGR2 could be used as a protein marker for epidermal growth factor receptor gene mutations in patients with lung adenocarcinoma, which may be a potential clinical biomarker for the sensitivity of EGFR-TKI therapy in lung adenocarcinoma cells proved in vitro experiments. The expression of AGR2 protein contributes to the histological classification of non-small cell lung cancer and has important clinical value in the differential diagnosis of adenocarcinoma and squamous cell carcinoma[32]. AGR2 reduced the cell cycle progression while enhancing the invasive nature of prostate cancer cells. A new research approach for prostate cancer markers and the control of tumor growth and invasion is now available because to the improvements of the expression pattern and expression level of AGR transcripts in urine sediment of prostate cancer patients[33]. Ras Interactor 1 (RIN1) is a Rab5 guanine nucleotide exchange factor that is crucial for the trafficking of growth factor receptors and RAS-activated fibroblast endocytosis[34]. Tomshine et al.[35] found that the up-regulation of Rin1 in A549 cell line due to its proliferation and may be important factors in the development of non-small cell lung cancer. Frasl related extracellular matrix 1 (FREM1) is an extracellular matrix protein involved in the development of multiple organ systems. Recessive mutations of FREM1 lead to eye defects, congenital diaphragmatic hernia, renal abnormalities and anorectal malformations[36].

GO and KEGG enrichment analysis

GO enrichment analysis showed that DEGs of goat lung tissue enriched 52 GO categories, involving 17 "cellular components", 23 "biological processes" and 12 "molecular functions". The DEGs of rat lung tissue enriched 51 GO categories, involving 15 "cellular components", 23 "biological processes" and 13 "molecular functions". The KEGG pathway enrichment analysis of DEGs revealed that BLI goats were engaged in 256 pathways, of which 26 were significantly enriched, helping to further clarify their molecular and biological activities. At the same time, 12 pathways were significantly enriched of BLI rats among the 287 pathways based on the DEGs enrichment analysis. The enrichment of these pathways provides a direction for the study of the molecular mechanism of BLI. Both goat and rat species exhibited significantly enriched IL-17 signaling pathways, suggesting that IL-17 signaling pathways may provide information about future research of BLI mechanisms. As an important proinflammatory factor secreted by T helper cells (Th17), IL-17 is related with the occurrence and development of inflammatory reactions and immune diseases. IL-17 has been extensively reported in the study of lung injury. IL-17 binding to IL-17 receptor form the complex IL-17R-ACT1-TRAF6 and then activates downstream NF-KB, JNK and other signaling pathways[37]. IL-17A/IL-17RA affected the migration and invasion of lung cancer by increasing the expression of MMP-2 and MMP-9 in non-small cell lung cancer cells, resulting in enhanced phosphorylation of P38[38]. Erika et al.[39] performed high-throughput siRNA screening on IL-17A-stimulated human lung epithelial cells to identify TNF-α and IL-1β induced cellular inflammatory responses in order to better understand IL-17RA signaling pathway. IL-17 also was also involved in COPD. Electroacupuncture stimulation can effectively improve the lung function of COPD rats, reduce the infiltration of pneumonia, and down-regulate the increase of IL-17R mRNA and protein expression in the lung tissue of COPD rats, and the levels of phosphorylated JNK, ERK1/2 and p38 were significantly inhibited, which may be related to the inhibition of IL-17/IL-17R and post-receptor MAPK signaling pathway [40]. IL-17 is an important regulator of increased permeability of endothelial cells, increasing permeability of endothelial monolayers in a dose-and time-dependent manner[41]. In conclusion, gene co-expression network analysis can analyze gene expression data and then reflect the system status of cells or tissues. Our findings suggest that the common features of these two species are mainly involved in the regulation and activation of inflammatory and immune responses. GO and KEGG pathway analysis showed that IL-17 signaling pathway was highly enriched in the genes co-differentially expressed in goat and rat lung tissues, which provided a direction for the study of the mechanism of blast shock wave lung injury. Furthermore, the vascular smooth muscle contraction pathway was also screened in the sequencing data of this study. Alveolar rupture and internal hemorrhage are the main changes of BLI because of abundant pulmonary blood vessels. Under the action of shock wave, vascular smooth muscle constricts blood vessels and slows blood flow through axonal reflex, which is conducive to blood coagulation and hemostasis, and activates or produces some factors at the same time. This is also one of the directions that need to explore in the BLI subsequent research.

Though our research has got certain results, there is also some deficiency. Whether the target genes screened in this study are sensitive and specific to BLI and whether they are sufficient and necessary conditions still need to be further studied to differentiate BLI from other lung injuries. The histological staining of these genes in BLI tissue would help clarify the challenges associated with performing in gene expression changes, which need to be further researched in the follow-up study. We also think sorting of purified subpopulations for bioinformatic analyses is more suitable for single-cell sequencing. Due to the restricted environmental conditions of the field-testing, we didn’t sort the purified subpopulations under the. In the follow-up research, the purified subpopulations of gene expression changes will be considered. In addition, future research is required to determine whether there is a dose-effect link between the levels of expression of these target genes and the degrees of harm (mild, moderate, and severe). At the same time, these genes are derived from animal test results, whether they are suitable for humans lacking of clinical trial and epidemiological survey data support.

On the basis of the BLI model of goat and rat, transcriptome sequencing was performed in the lung tissues of the two species. The results showed that IL-17 signaling pathway and vascular smooth muscle contraction pathway are involved in BLI mechanism. AGR2, ANKRD65, BPIFA1, BPIFB1 and KRT4 were highly expressed in both goat and rat BLI model. The results showed that these proteins could be used as potential target genes for BLI and also could be used as indicators for diagnosing, treating and preventing diseases.

Animals and ethics approval

A total of six healthy male goats weighing 25–30 kg were purchased from the Inner Mongolia Autonomous Region's Alxa League. The Huafukang Bioscience Co., Ltd. provided 10 healthy SPF-bred male Sprague Dawley (SD) rats aged 8–9 weeks and weighing 200-250g. All protocols and procedures were approved by the Ethics Committee of Institute for Hygiene of Ordnance Industry in Xi'an, China and were conducted in accordance with the guidelines of the National Institutes of Health on the care and use of animals. As shown in Fig. 8 below, a brief overview of the study's protocol was conducted.

BLI model building

The BLI model was completed by carrying a Fuel Air Explosive (FAE) power test in free air[42, 43]. The detailed method of BLI model is referred to the previous papers published by our research team[44, 45]. As shown in Fig. 8, the FAE was implemented on the top of a bracket 3 m above the ground. Ten rats and three goats of the test group were fixed on the arc of 35 meters from explosion center. Shock wave data were obtained from the pressure sensor (113B24, PCB, USA), transmitted through a data cable and stored on a computer, and the measured value of the shock wave overpressure was 0.245 Mpa. The same number of control group animals were fixed 3 kilometers away from the explosive area with no shock wave.

H&E staining of lung tissues

Rats were anesthetized with the pentobarbital intraperitoneal injection at a dose of 30mg/kg. Goats were sacrificed by carotid artery exsanguination. After the animals were dissected, the lungs were collected and fixed for a week in 4% (w/v) formaldehyde, dehydrated using a fully enclosed tissue processor (ASP300 S; Leica, Wetzlar, Germany), and then embedded in paraffin (EG1150H + C; Leica Biosystems). The H&E Staining System (ST5020; Leica) was used to stain sections of preserved paraffin lung tissues after they were cut into 5 µm thick slices using a microtome (RM2245; Leica). The sections were visualized with a light microscope (DM4000B; Leica).

Lung tissue sampling and RNA extraction

24 hours after the successful construction of BLI model, the goats and rats were dissected, and a small piece of left middle lung tissue was removed to extract total RNA using Trizol reagent. The purity of the sample was detected by NanoPhotometer® spectrophotometer, and the concentration of RNA sample was detected by fluorescence quantifier.

RNA sequencing

The construction of the RNA library and sequencing were performed by Annoroad Gene Technology Co., Ltd. Located in Beijing. Steps in detail are as follows[46, 47]: After qualified RNA samples were tested, 3µg of total RNA was used as starting material for constructing transcriptome sequencing library according to the instructions of NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (#E7530L, NEB, USA) and index codes were added to attribute sequences to each sample. The mRNA was purified from Total RNA with Oligo (dT) magnetic beads and broken into short fragments by fragmentation buffer, which was used as template to synthesize first-strand cDNA with random primers. In the first step, we synthesized the single strand cDNA based on random hexamer primers and RNase H. Then the second strand cDNA synthesis was subsequently performed using buffer, dNTPs, DNA polymerase I and RNase H. Following the double strand cDNA was obtained after purification. A tail was added and the sequencing connector was connected. Sequencing was performed using an Illumina HiSeq Xten sequencer with a PE150 sequencing strategy. A high quality sequence (Clean Data) was obtained by removing contaminated joints or low quality base data, and Q20 and Q30 were calculated to determine the quality of the test data. A FASTQ file format was used to store the data. The number of sequences aligned to exons, introns, and intergenic regions was used to assess sequencing quality.

Data analysis

The DEGs were identified with the DESeq2 software using a threshold (q ≤ 0.05 and |log2 fold change| ≥ 1)to determine the number of up-regulated and down-regulated genes. The GO Ontology database was used to analyze DEGs that were significantly enriched(q ≤ 0.05). DEGs were categorized into three terms: biological process (BP), cell composition (CC), and molecular function (MF). Kyoto Encyclopedia of Genes and Genomes (KEGG) was performed to find significant enrichments for genes that were related to each other. The q-value < 0.05 was considered that these genes were significantly expressed. It was considered that these genes were significantly expressed.

Target gene screening and validation

From the differentially expressed genes of the two species, the genes with the same expression trend, expressed only in lung tissue or tended to be the target of lung tissue were further screened and verified by q-PCR. The genes co-expressed in goat and rat lung tissues with the same change trend were selected for q-PCR test. The primer sequences were identified as shown in Table 3. Detailed methods are as follows: First-strand cDNA was synthesized using the PrimerScript™ RT Reagent Kit with cDNA Eraser (TaKaRa, Dalian, China). qRT-PCR was performed on of each sample in triplicate using SYBR® Premix Ex Taq (TaKaRa, Dalian, China) on 7500 Fast Real-Time PCR system (Applied Biosystems). The PCR amplification procedure was as follows: initial denaturation at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. The 2 − ΔCT method was used to analyze the relative changes in transcript expression. The concentration of BPIFA1, BPIFB2, KRT4, AGR2, ANKRD65 and RIN1 in serum were detected by ELISA according the instructions (Shanghai Enzyme linked Biotechnology Co., Ltd).

Table 3

Primer sequences used in q-PCR.
Gene	Forward primer (5’ to 3’)	Reverse primer (5’ to 3’)
AGR2	ATGTACGGGCATCCTCACCA	GCCACAAGAAGCAGGATTGC
ANKRD65	GCTTAGGCCACCACCAAGAA	GTCTCGAGCATCTACGTCGG
BPIFA1	ACACCCACTGAGACCTTAAGAC	GCTCACGGCCAAAGGCAG
BPIFB1	TCGCTTGGGTCTTAGAGGCT	ACTTCTGGGCCAAGGTTGAG
FREM1	GCTTGGGTTGCTCCAACATT	TGCTGGTTACTGACGGACAC
KRT4	AGACTCTGCAGGCATCTGTG	GAGCTCCTGGTAGTCCCTCA
RIN1	CAAGAGTTAACTGGCGGGGT	TCGGTCTCACCAGGGTCTTC

Acknowledgements

The authors would like to thank the professor Qian AR. team from School of Life Sciences in Northwestern Polytechnical University for Design and guidance of the study.

Authors’ contributions

Hong Wang designed the study and writed the original draft. Junhong Gao provided funding support. Xiaolin Fan conducted experiments and drew the figures. Qing Lu and Ning Ma collected the data. Qi Wang and Liang Li helped with the data analysis and validation. Wenjuan Zhang contributed to critically reviewing the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Defense Foundation Enhancement Program of Technical Area Fund of China (NO. JCJQ-2020-01 and JCJQ-2020-03).

Availability of data and materials

Data generated for this study can be found in the Sequence Read Archive (SRA) Database at the National Center for Biotechnology Information(NCBI), SRA accession: PRJNA563779 and PRJNA826833. https://www.ncbi.nlm.nih.gov/sra/

Ethics approval and consent to participate

All methods were carried out in accordance with relevant guidelines and regulations. The protocols for all animal experiments were approved by the Animal Welfare Committee of nstitute for Hygiene of Ordnance Industry (No. BQDL-2019-006). In addition, the study is reported in accordance with ARRIVE guidelines ((https://arriveguidelines.org).

Consent for publication

Not applicable.

Competing interests

The authors declare no conflict of interest.

Magnusa D, Mansoor AK, William GP. Epidemiology of civilian blast injuries inflicted by terrorist bombings from 1970-2016. Defence Technology. 2018;14(5):469-476.
Scott TE, Kirkman E, Haque M, Gibb IE, Mahoney P, Hardman JG. Primary blast lung injury - a review. Br J Anaesth. 2017;118(3):311-316.
Zhao Y, Zhou Y-G. The past and present of blast injury research in China. Chin J Traumatol. 2015;18(4):194-200.
Mackenzie IM, Tunnicliffe B. Blast injuries to the lung: epidemiology and management. Phil Trans R Soc B. 2011;366(1562):295-299.
Tong CC, Liu YN, Zhang YB, Cong PF, Shi XY, Liu Y, Hou MX. Shock waves increase pulmonary vascular leakage, inflammation, oxidative stress, and apoptosis in a mouse model. Exp Biol Med (Maywood). 2018;243(11):934-944.
Alastair B, Paul P. Blast injuries: a guide for the civilian surgeon. Surgery (Oxford) 2018;36(8):394-401.
McAuley DF, Matthay MA. Clara cell protein CC16. A new lung epithelial biomarker for acute lung injury. Chest. 2009;135(6):1408-1410.
Wu F, Ding B, Yang X, Ma D, Zhang C, Hua C. Club cell protein 16 as a biomarker in pulmonary contusion. Biomed Rep. 2016;5(2):251-253.
Auner B, Geiger EV, Henrich D, Lehnert M, Marzi I, Relja B. Circulating leukotriene B4 identifies respiratory complications after trauma. Mediators Inflamm. 2012;2012:536156.
Ware LB, Conner ER, Matthay MA. von Willebrand factor antigen is an independent marker of poor outcome in patients with early acute lung injury. Crit Care Med. 2001;29(12):2325-2331.
Agrawal A, Matthay MA, Kangelaris KN, Stein J, Chu JC, Imp BM, Cortez A, Abbott J, Liu KD, Calfee CS. Plasma angiopoietin-2 predicts the onset of acute lung injury in critically ill patients. Am J Respir Crit Care Med. 2013;187(7):736-742.
Fremont RD, Koyama T, Calfee CS, Wu W, Dossett LA, Bossert FR, Mitchell D, et al. Acute lung injury in patients with traumatic injuries: utility of a panel of biomarkers for diagnosis and pathogenesis. J Trauma. 2010;68(5):1121-1127.
Vishnupriya S, Priya Dharshini LC, Sakthivel KM, Rasmi RR. Autophagy markers as mediators of lung injury-implication for therapeutic intervention. Life Sci. 2020;260:118308.
Lumley A, Osborn E, Mellor A, LaCroix E, Johnson G, Wallace M, Stacey M, et al. The role of neutrophil gelatinase-associated lipocalin (NGAL) in the detection of blast lung injury in a military population. J Crit Care. 2018;43:312-315.
Aronson JK, Ferner RE. Biomarkers-A General Review. Curr Protoc Pharmacol. 2017;76:9.23.1-9.23.17.
dos Santos CC, Okutani D, Hu P, Han B, Crimi E, He X, Keshavjee S, Greenwood C, et al. Differential gene profiling in acute lung injury identifies injury-specific gene expression. Crit Care Med. 2008;36(3):855-865.
Rajasekaran S, Pattarayan D, Rajaguru P, Sudhakar Gandhi P, Thimmulappa RK. MicroRNA Regulation of Acute Lung Injury and Acute Respiratory Distress Syndrome. J Cell Physiol. 2016;231(10):2097-2106.
Zhou XJ, Gibson G. Cross-species comparison of genome-wide expression patterns. Genome Biol. 2004;5(7):232.
Gerstein MB, Rozowsky J, Yan KK, Wang D, Cheng C, Brown JB, et al. Comparative analysis of the transcriptome across distant species. Nature. 2014, 512, 445-448.
Contreras-López O, Moyano TC, Soto DC, Gutiérrez RA. Step-by-Step Construction of Gene Co-expression Networks from High-Throughput Arabidopsis RNA Sequencing Data. Methods Mol Biol. 2018;1761:275-301.
Saferali A, Tang AC, Strug LJ, Quon BS, Zlosnik J, Sandford AJ, Turvey SE. Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1. PLoS One. 2020;15(1):e0227067.
Britto CJ, Niu N, Khanal S, Huleihel L, Herazo-Maya JD, Thompson A Sauler M, et al. BPIFA1 regulates lung neutrophil recruitment and interferon signaling during acute inflammation. Am J Physiol Lung Cell Mol Physiol. 2019;316(2):L321-L333.
Shum AK. Autoantibodies against BPI fold containing family B member 1 (BPIFB1) to diagnose autoimmune interstitial lung disease (ILD). Science Business Exchange. 2013;1278.
Shum AK, Alimohammadi M, Tan CL, Cheng MH, Metzger TC, Law CS, et al. BPIFB1 is a lung-specific autoantigen associated with interstitial lung disease. Sci Transl Med. 2013;5(206):206ra139.
Smet ED, Seys LJ, Verhamme FM, Vanaudenaerde BM, Brusselle GG, Bingle CD, Bracke KR, Association of innate defense proteins BPIFA1 and BPIFB1 with disease severity in COPD. Int J Chron Obstruct Pulmon Dis. 2017;13:11-27.
Gao J, Ohlmeier S, Nieminen P, Toljamo T, Tiitinen S, Kanerva T, Bingle L, et al. Elevated sputum BPIFB1 levels in smokers with chronic obstructive pulmonary disease: a longitudinal study. Am J Physiol Lung Cell Mol Physiol. 2015;309(1):17-26.
Li J, Xu P, Wang L, Feng M, Chen D, Yu X, Lu Y. Molecular biology of BPIFB1 and its advances in disease. Ann Transl Med. 2020;8(10): 651.
Sakamoto K, Aragaki T, Morita K, Kawachi H, Kayamori K, Nakanishi S, Omura K, et al. Down-regulation of keratin 4 and keratin 13 expression in oral squamous cell carcinoma and epithelial dysplasia: a clue for histopathogenesis. Histopathology. 2011;58(4):531-542.
Zhang J, Quan J, Ren Y, Chen M, Yang J, Zhang X. Keratin 4 regulates the development of human white sponge nevus. J Oral Pathol Med. 2018;47(6):598-605.
Kanazawa H, Kita A, Ishida N, Miyamoto I, Kasamatsu A, Uzawa K. Sporadic white sponge nevus caused by a mutation in the keratin 4 gene. Oral and Maxillofacial Surgery Cases. 2020;6(4):100190.
Narumi S, Miki Y, Hata S, Ebina M, Saito M, Mori K, Kobayashi M, Suzuki T, et al. Anterior gradient 2 is correlated with EGFR mutation in lung adenocarcinoma tissues. Int J Biol Markers. 2015;30(2):e234-242.
Pizzi M, Fassan M, Balistreri M, Galligioni A, Rea F, Rugge M. Anterior gradient 2 overexpression in lung adenocarcinoma. Appl Immunohistochem Mol Morphol. 2012;20(1):31-36.
Bu H, Bormann S, Schäfer G, Horninger W, Massoner P, Neeb A, Lakshmanan VK, et al. The anterior gradient 2 (AGR2) gene is overexpressed in prostate cancer and may be useful as a urine sediment marker for prostate cancer detection. Prostate. 2011;71(6):575-587.
Wang Q, Gao Y, Tang Y, Ma L, Zhao M, Wang X. Prognostic significance of RIN1 gene expression in human non-small cell lung cancer. Acta Histochem. 2012;114(5):463-468.
Tomshine JC, Severson SR, Wigle DA, Sun Z, Beleford DA, Shridhar V, Horazdovsky BF. Cell proliferation and epidermal growth factor signaling in non-small cell lung adenocarcinoma cell lines are dependent on Rin1. J Biol Chem. 2009;284(39):26331-26339.
Beck TF, Shchelochkov OA, Yu Z, Kim BJ, Hernández-García A, Zaveri HP, et al. Novel frem1-related mouse phenotypes and evidence of genetic interactions with gata4 and slit3. PLoS One. 2013:8(3):e58830.
Qu F, Gao H, Zhu S, Shi P, Zhang Y, Liu Y, Jallal B, Yao Y, Shi Y, Qian Y. TRAF6-dependent Act1 phosphorylation by the IκB kinase-related kinases suppresses interleukin-17-induced NF-κB activation. Mol Cell Biol. 2012;32(19):3925-37.
Wu Z, He D, Zhao S, Wang H. IL-17A/IL-17RA promotes invasion and activates MMP-2 and MMP-9 expression via p38 MAPK signaling pathway in non-small cell lung cancer. Mol Cell Biochem. 2019;455(1-2):195-206.
Erika, Rickel.; Mike, O.; Elisa, Swearingen.; Paul, K.; Jennifer, E.; et al. High-throughput SiRNA screen to identify novel signaling molecules in the IL-17RA signaling pathway. Cytokine, 2013;63(3):293.
Zhang XF, Xiang SY, Lu J, Li Y, Zhao SJ, Jiang CW, Liu XG, et al. Electroacupuncture inhibits IL-17/IL-17R and post-receptor MAPK signaling pathways in a rat model of chronic obstructive pulmonary disease. Acupunct Med. 2021;39(6):663-672.
You QH.; Sun GY, Wang N, Shen JL, Wang Y. Interleukin-17F-induced pulmonary microvascular endothelial monolayer hyperpermeability via the protein kinase C pathway. J Surg Res. 2010;162(1):110-121.
Bai C, Zhao X, JIAN Yao, J, Sun B. Numerical investigation of the shockwave overpressure fields of multi-sources FAE explosions. Defence Technology. 2021;17(4):1168-1177.
Liu G, Hou F, Cao B, Xie L, Shen Z, Zhou T. Experimental study of fuel-air explosive. Combust Explos Shock Waves. 2008;44(2):213-217.
Wang H, Zhang WJ, Gao JH, Liu JR, Liu ZY, Xia BQ, Fan XL, Li CZ, Qian AR. Global gene expression profiling of blast lung injury of goats exposed to shock wave. Chin J Traumatol. 2020;23(5):249-257.
Wang H, Zhang WJ, Liu JR, Gao JH, Fang L, Liu ZY, Xia BQ, Fan XL, Li CZ, Lu Q, Qian AR. NF-κB and FosB mediate inflammation and oxidative stress in the blast lung injury of rats exposed to shock waves. Acta Biochim Biophys Sin. 2021;53(3):283-293.
Tao L, He X, Jiang, Y, Liu, Y, Ouyang Y, Shen Y, Hong Q, Chu M. Genome-Wide Analyses Reveal Genetic Convergence of Prolificacy between Goats and Sheep. Genes (Basel). 2021;12(4):480.
Qian X, Ba Y, Zhuang Q, Zhong G. RNA-Seq technology and its application in fish transcriptomics. OMICS. 2014;18(2):98-110.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Screening co-expressed target genes in rats and goats of blast lung injury through comparative transcriptomic analysis

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

Background

Result

Discussion

Conclusions

Materials And Methods

Declarations

References

Additional Declarations

Status:

Version 1