Excess Iron added to the diet induces the apoptosis of chicken’s liver through the PI3KAKT mTOR axis

doi:10.21203/rs.3.rs-2212549/v1

Download PDF

Research Article

Excess Iron added to the diet induces the apoptosis of chicken’s liver through the PI3KAKT mTOR axis

https://doi.org/10.21203/rs.3.rs-2212549/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Iron (Fe), an essential trace element, plays a key role in biological metabolism. The PI3K/AKT/mTOR axis plays an important role in the control of apoptosis. However, the effect of iron overdose in the diet on the role of the PI3K/AKT/mTOR axis and apoptosis, and pathological liver damage in chickens are still poorly understood. In this study, 180 1-day-old chicks were divided into 3 groups, which were fed the basal diets supplemented with 50 (C), 500 (E1), and 1000 (E2) mg Fe/Kg as ferrous sulfate monohydrate (FeSO₄·H₂O) and returned to normal diet one day later, Tested on days 1, 3, 7, 14, and 21 after the end of the iron addition. The results showed that the liver morphology was normal in the group C. The groups E1 and E2 showed the structure destroyed of hepatic lobules, the disordered of hepatic cords, the reduction of the central veins and the presence of erythrocytes accompanied by inflammatory cell infiltration. The group E2 showed more serious damage than the group E1, but these phenomena will largely return to normal on day 21. The perls staining showed that large deposits of iron-containing hemosiderin in the hepatic sinus after iron overdose intake, and the changes of iron deposition and pathological damage had certain regularity in time. The expression of Bax, Caspase-3, Caspase-8, and Caspase-9 in groups E1 and E2 were increased from days 1 to 21, which was in contrast to the Bcl-2, and it has a dose dependent. This suggested that iron overdose triggered apoptosis, which was supported by our ultrastructural observations of chromatin marginalization and impaired mitochondrial swelling. In addition, the expression of PI3K and AKT were significantly increased in the iron overdose groups, while the expression of mTOR was decreased. Above all, iron overdose can induce apoptosis in chicken hepatocytes through regulation of the PI3K/AKT/mTOR axis, leading to pathological damage. The type of iron overdose-induced damage was dose-dependent but not permanent. These results provide a theoretical basis for a comprehensive understanding of the importance of mineral nutrition management in poultry and the possible risk of excessive iron intake.

Cell Survival and Cell Death

Chicken liver

Iron overdose

Apoptosis

Pathological damage

PI3K/AKT/mTOR

Iron (Fe) is an essential nutrient for the growth and development of animals (Torti and Torti, 2013). In practice, additional iron is usually added to the basal feed in order to improve the performance of chicks (Sarlak et al., 2021). The most suitable nutritional requirement of poults for iron is 50–100 mg/Kg of feed, while the tolerance level is 500 mg/Kg of feed, as stipulated in the Agricultural Industry Standard of the People's Republic of China < Chicken Feeding Standard>. Because there is no active regulatory mechanism to eliminate excess iron from the body, long-term iron supplementation or excessive exogenous ingestion of iron can lead to excessive iron deposition and induce related diseases (Kadam et al., 2021), dietary iron intake needs to be strictly controlled. Recent evidence suggests that high dietary iron can disrupt the body's iron homeostasis, and lead to iron accumulation in the liver (Chen et al., 2019; Yu et al., 2020). The Perls stain can quantify the concentration of iron in tissues, and it is a simple and direct way to determine iron deposition (Alves et al., 2021). In addition, iron accumulation eventually leads to associated pathological damage, such as oxidative stress and ferroptosis (Mancardi et al., 2021), while the production of reactive oxygen (ROS) and excessive depletion of antioxidants during oxidative stress can accelerate apoptosis (Su et al., 2019; Hayes et al., 2020). An increasing number of studies have shown that iron levels affect the physiological function and tissue structure of poultry (Gou et al., 2020; Lu et al., 2022), and that apoptosis plays an important role in the development of diseases caused by excessive iron (Zhou et al., 2018).

In healthy animal livers, the majority of liver cells are in resting phase (G₀), with little cell death (Li et al., 2014). This state becomes disturbed in liver disease induced by metabolic or autoimmune damage, and inducing hepatocyte death or apoptosis. This subsequently leads to the development of diseases such as inflammation, fibrosis, cirrhosis and hepatocellular carcinoma(Brenner et al., 2013; Higashi et al., 2017; Ueno and Komatsu, 2017). The liver is also the main organ of iron storage in the body which is sensitive to imbalances in iron homeostasis (Labranche et al., 2018). When iron supply exceeds demand, it may cause liver damage (Ma et al., 2021). In addition, the liver has a strong regenerative and metabolic capacity compared to most other organs (Unzu et al., 2019), and its ability to rapidly regulate pathogenic damage reflects the important role of the liver in many processes.

Cell death can take many forms, and the death of different populations of liver cells can lead to liver damage in each disease (Shojaie et al., 2020), which triggers different responses and biological outcomes. Thus, we can learn that specific cell death patterns are situation-specific, and these studies may lead to many opportunities for the treatment of animal diseases. Apoptosis is one of the more established modes of cell death discovered in the last decades. It is characterized that can be executed in a structed manner by a specific suicide plan (Cheng and Ferrell, 2018). Morphologically, apoptosis often appears as a coalescence of organelles and chromatin, and a decrease in cell and nucleus volume (Prokhorova et al., 2015). This is in contrast to the swelling and rupture of structure in other necrotic cells (Riegman et al., 2020). The regulatory mechanisms of apoptosis are complex. It includes regulation through a mitochondria-dependent pathway-mediated caspase cascade, and members of the bcl-2 genes family have a central role through the control of pro- and anti-apoptotic intracellular signaling (Ashkenazi et al., 2017; Nagata, 2018). The PI3K/AKT/mTOR axis maintains cell development, stability and essential functions. It is considered as a critical node for controlling cell growth, migration, proliferation and metabolism. Recent studies have found that activation of apoptotic signaling is closely associated with the PI3K/AKT pathway (Zheng et al., 2021). In addition to this, mTOR is a stress-activated protein kinase (Battaglioni et al., 2022), which can be activated downstream of extracellular signaling mediated during apoptosis (Chen and Zhou, 2020). Many studies have reported that the regulation of growth factors and neurotransmitters involves the PI3K/AKT pathway, which is critical for cell survival (Tewari et al., 2022). When apoptotic signals are activated, both pro- and anti-apoptotic signals may be activated simultaneously. Cells die only when anti-apoptotic signals are inhibited (Gupta et al., 2021).

Currently, the role of iron overdose in the injury mechanism of apoptosis in chicken’s liver is unclear. In our study, we established a chick liver iron overdose damage model. Pathological changes were observed under light microscopy and ultrastructural changes by electron microscopy. The expression of apoptosis-related genes and changes of PI3K/AKT/mTOR levels were then explored.

Animals and Diets

All procedures used in this study were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University. A total of 180 one-day-old healthy chickens (Xianfeng Poultry Industry Co. Ltd., Harbin, China) were randomly selected in 3 groups with 60 chickens in each group, which were fed the basal diets supplemented with 50 (C), 500 (E1), and 1000 (E2) mg Fe/kg as ferrous sulfate monohydrate (FeSO₄·H₂O). We disinfected the animals’ housing, ensured the brooding temperature, and let the chickens eat and drink freely. The 12 chickens in each group were euthanized with sodium pentobarbital. Their liver tissues and blood were collected on days 1, 3, 7, 14, and 21. Part of the liver tissue was detected immediately, part was placed in fixative solution, and the other part was stored at -80°C.

Pathological Observations

The livers were placed on a blue plastic plate. Compare the color and size between the different groups and take pictures to record. Meanwhile, the livers were sliced into a size of 5.0 × 5.0 ×5.0 mm with a pre-cooled blade. They were fixed in 10% formalin solution at room temperature for 2 ~ 3 days, followed by paraffin embedding. Paraffin sections, H&E staining, and perls staining were prepared according to conventional histology methods. The sections were observed under a light microscope for morphological observation.

Liver samples were cut into small pieces (approximately 1 mm³), fixed in 0.1 mmol/L (3%, w/v) sodium cacodylate buffer (pH = 7. 4) for 2h at 4°C, and postfixed in 1% osmium tetroxide. These samples were then embedded in epoxy resin and cut into ultra-thin sections (70 nm), Stained with uranyl acetate and lead citrate, and observed under a transmission electron microscope.

Iron Analysis

0.1 g of chicken liver was added to 0.9 mL of saline, mechanically homogenized in an ice-water bath, centrifuged at 3500 rpm for 10 min, and the supernatant was collected. The protein concentration was measured by the bicinchoninic acid (BCA) method according to the manufacturer’s instructions (Jiancheng-Bio, Nanjing, China). The iron content of the liver was measured by absorbance values at 520 nm and calculated according to the following formula.

$$Iron content=\frac{Determine OD value-Blank OD value}{Standard OD value-Blank OD value}\times Standard concentration÷ Sample protein concentration to be measured$$

The Enzyme Activity was Analysis.

5mL of blood was collected by aseptic jugular vein collection method. The blood was left at room temperature for 30min, then centrifuged at 3000 r/min for 10 min, and the ALT and AST levels of the isolated serum were detected by a fully automated biochemical analyzer (Shenzhen Myriad Biomedical Electronic Co., Ltd., BS-350E).

Quantitative Real-Time PCR ( qRT-PCR ) Analysis

The total RNA was extracted from chicken liver by Trizol extraction. cDNA was synthesized from 1µg RNA using iScript cDNA synthesis kit (Bio-Rad, USA). Primers sequences and amplicon sizes of genes were designed using Oligo primer analysis software (Version 7.0, Oligo®) according to the genomic and cDNA sequences of chicken and synthesized by Sangon Biotech (Shanghai, China) (Table 1). All samples were performed in triplicate according to the manufacturer’s instructions (TaKaRa, China), and qRT-PCR was performed on a Roche LightCycler 480II System (Roche, Switzerland) in a 20µL reaction. The qRT-PCR was performed with the following protocol: 95°C for 2 min, 46 cycles of 95°C for 10s, annealing at 58.7°C for 30s, extension 72°C for 15s. Fluorescence signal was detected during annealing extension. The GAPDH was used as an internal reference control. Experiments repeated, the 2 ^–ΔΔCt method was used for calculation and analysis.

Table 1

Primers sequences and amplification fragments sizes of gene were used
Names of primers	Sequences	Product length (bp)	No.of genes
GAPDH(F)	AGAACATCATCCCAGCGT	182	NM_204305.2
GAPDH(R)	AGCCTTCACTACCCTCTTG	182	NM_204305.2
PI3K(R)	TAGTGGTGGACGGCGAAGTA	151	XM_047417317.1
PI3K(F)	TTGAGGGAGTCGTTGTGCTG	151	XM_047417317.1
AKT(R)	ATGGAATGGACGAAGAGG	290	CP100559.1
AKT(F)	ATCCGTGGACGATACTGG	290	CP100559.1
mTOR(R)	CATGTCAGGCACTGTGTCTATTCTC	77	CP100575.1
mTOR(F)	CTTTCGCCCTTGTTTCTTCACT	77	CP100575.1
Bax(R)	TCCATTCAGGTTCTCTTGACC	119	XM_040662228.2
Bax(F)	GCCAAACATCCAAACACAGA	119	XM_040662228.2
Bcl-2(R)	ATCGTCGCCTTCTTCGAGTT	150	NM_205339.3
Bcl-2(F)	ATCCCATCCTCCGTTGTTCT	150	NM_205339.3
Caspase-3(R)	CTGAAGGCTCCTGGTTTA	104	XM_050338019.1
Caspase-3(F)	TGCCACTCTGCGATTTAC	104	XM_050338019.1
Caspase-8(R)	CCCTGAAGACAGTGCCATTT	106	NM_204592.4
Caspase-8(F)	GGGTCGGCTGGTCATTTTAT	106	NM_204592.4
Caspase-9(R)	ATTCCTTTCCAGGCTCCATC	130	CP100575.1
Caspase-9(F)	CACTCACCTTGTCCCTCCAG	130	CP100575.1

Western Blotting Analysis

The proteins were subjected to SDS-polyacrylamide gel electrophoresis on 12% gel, and then the separated proteins were transferred to a nitrocellulose membrane. After transfer printing, the membranes were blocked with 5% skim milk at 37°C for 2h. The diluted primary antibody (Wanlei-BIO, Shenyang, China) and GAPDH monoclonal antibody (Wanlei-BIO, Shenyang, China) were incubated overnight. After washing, the membranes were incubated with secondary horseradish-conjugated (Abclonal, Heilongjiang, China) antibodies and detected using ECL system (NCM Biotech, China). ImageJ software was used to detect the integrated density (IntDen) of each band, and the protein expression level was expressed as the ratio of IntDen of the target protein to IntDen of GAPDH.

Statistical Analysis

Statistical analysis of all data was performed using SPSS for Windows (version 19, SPSS Inc., USA). Differences between the experiment group and the control group were considered to be significant at P < 0.05 and highly significant at P ༜0.01. P < 0.05 was considered statistically significant. The data are expressed as the mean ± SD. All data showed a normal distribution and passed equal variance testing. Differences between means were assessed using two-tailed paired Student’s t test.

Histopathological Observation of the Liver

First, the pathological changes were observed by eye. Compared with the control group, the iron overdose group had darkened and congested liver color at days 1, 3, and 7 after iron overdose, and the group E2 was darker than the group E1. The color of the iron overdose group recovered at day 14, and on day 21, the color became normal reddish-brown (Figure. 1A).

In addition to this, in the group C, no iron-containing haematoxylin deposits were seen, and iron staining was negative. We found blue dark-stained iron ion deposits in the liver of the iron overdose groups. From days 1 to 14, the group E2 was more severe than the group E1, but it was basically gone at day 21 (Figure. 1B).

In addition, the effect of iron overdose on histopathological changes in the liver was shown under light microscopy (Figure. 2). In the group C, the hepatocytes were clear, and the nuclei were uniform in size and round. The shape of hepatocyte cords and hepatic lobules was regular (Figure. 2a). In the iron overdose groups, we can see that the degree of pathological damage to the liver varied with age, with lesions being somewhat more pronounced in the group E2 than the group E1. In the group E1, a small number of erythrocytes were present in the central vein on day 1 (Figure. 2b). On day 3, in addition to some erythrocytes, there was an infiltration of inflammatory cells (Figure. 2c). However, the other days of age did not differ much from the group C. In the group E2, infiltrating inflammatory cells were observed on day 1 (Figure. 2d). On day 3, the hepatocyte cords were irregularly, and the affected hepatocytes have pyknotic nuclei. At the same time, infiltrated inflammatory cells were also observed (Figure. 2e). On day 7, the central hepatic vein was filled with a large number of erythrocytes, and the hepatocytes were infiltrated with inflammatory cells, which mainly lymphocytes and macrophages, and a small number of hepatocytes were necrotic and lysed. As can be seen in figure, aggregation of infiltrating inflammatory cells, mildly thickened of the vein wall, and the hepatocytes were necrotic (Figure. 2f). Miraculously, these pathological damages changed on day 14, with a decrease in inflammatory cells (Figure. 2g). Even on day 21, we could see that the hepatocyte cords were regular, and the erythrocytes in the central vein are heavily reduced (Figure. 2h).

The ultrastructural changes of hepatocytes were observed using transmission electron microscopy (Figure. 3). We found that the mitochondria of the group C hepatocytes were intact and rounded with uniform electron density, and fine tubular cristae were visible (Figure. 3i). In contrast, the group E1 showed typical apoptotic features, including nuclear deformation, chromatin condensation and margination (Figure. 3j). The group E2 showed nuclear cleavage, swollen mitochondria and disorganized cristae (Figure. 3k, 3l).

Iron Content of the Liver

In chicken livers, iron content was elevated in the iron overdose groups from days 1 to 14, and the almost unchanged in group C. The group E2 was significantly higher than the group E1 (p < 0.05 or p < 0.01), and the iron content reached a maximum on day 7, but this phenomenon largely recovered on day 21 (Figure. 4A). (Asterisk indicated that there were significant differences between the group C and the iron overdose group at the same time point. Two symbols represent significant differences (p < 0.01) and one symbol represents a significant difference (p < 0.05). Each value represented the mean ± SD of five individuals, the same below)

Changes in Enzyme Activity

Serum levels of ALT and AST were significantly higher than the group C after iron overdose. They were significantly higher from days 1 to 3, and reached a maximum on day 3. However, they also recovered quickly, and the difference was not significant from day 7 (Figure. 4B).

mRNA Expression of Apoptosis Related Genes in Liver

The effect of iron overdose on the mRNA abundance of Bax, Bcl-2, Caspase-3, Caspase-8, and Caspase-9 was shown in Figure. 5. The qRT-PCR results revealed that iron overdose significantly increased the Caspase-3, Caspase-8, and Caspase-9 mRNA expression from days 1 to 21 and significantly increased the Bax mRNA expression from days 1 to 14, compared with the group C (P < 0.01 or P < 0.05). They consistently showed a trend of elevation from days 1 to 3 and decrease after day 3. Conversely, iron overdose significantly decreased Bcl-2 mRNA expression, with expression falling to a minimum by day 7 (P < 0.01 or P < 0.05)(Figure. 5A).

mRNA Expression of PI3K/AKT/mTOR Pathway Related Genes in Liver

To demonstrate the relationship between iron overdose and PI3K/AKT/mTOR signaling pathway of chick’s liver from transcriptional expression, PI3K, AKT, and mTOR were detected by qRT-PCR. The results showed that iron overdose significantly increased the PI3K and AKT mRNA expression and decreased the mTOR mRNA expression (P < 0.01 or P < 0.05), compared with the group C. From days 3 to 14, the expression of PI3K mRNA was significantly higher in the group E2 than the group C (P < 0.01); From days 1 to 21, the expression of AKT mRNA was significantly higher in the iron overdose groups than the group C; from days 1 to 3, the expression of mTOR mRNA was significantly lower in the iron overdose groups than the group C (P < 0.01 or P < 0.05). In the above results, changes were more pronounced in the group E2 than the group E1, except for AKT, and these differences were largely restored by day 21(Figure. 5B).

Western Bolt Analysis of PI3K/AKT/mTOR Levels

To demonstrate the relationship between iron overdose and PI3K/AKT/mTOR signaling pathway of chicken’s liver from protein expression, PI3K, AKT, and mTOR was detected by Western blotting. PI3K and AKT protein levels were increased and mTOR protein levels were decreased in the iron overdose groups compared to the group C. From days 1 to 3, PI3K protein content in the liver of the group E2 was significantly higher than that of the group C (p < 0.01). From days 1 to 14, the AKT protein content was significantly higher in the group E2 than the group C (p < 0.01). However, the mTOR protein content decreased in the iron overdose groups in the liver, compared to the group C. At day 7, the group E1 was significantly lower than the group C (p < 0.01), and from days 7 to 21, the group E2 was highly significantly lower than the group C (p < 0.01) (Figure. 6).

Iron is an indispensable trace element for the organism, and iron intake through food is an effective way to prevent and improve iron deficiency (Anderson and Frazer, 2017). In actual production, in order to improve the performance of chickens, extra iron is usually added to the basic feed. However, long-term iron supplementation or exogenous ingestion of iron can lead to excessive iron deposition and induce related diseases. Iron overdose model in laying hens have found that excessive iron also leads to elevated serum iron levels (Sarlak et al., 2021). The liver is highly specific for iron uptake, utilization, storage and secretion (Protchenko et al., 2021). It is the main organ of iron storage in the body and is more susceptiblein the body's iron levels. The results of the present study showed that iron content in the liver was increased with increasing levels of iron added to the diet, indicating a dose-dependent relationship between body iron content and dietary iron levels. This is consistent with the results of experiments with sheep (Liu et al., 2020). Excessive iron intake can lead to iron deposition, but interestingly, this phenomenon largely returns to normal over a period of time. This suggests that iron deposition due to excess iron intake is time-limited and that iron levels can be restored by the regulatory action of the body. At the same time, we could visualize by perls staining, the results of which echoed the trend of iron content measurement. The deposited iron was deposited in the hepatic sinusoid in the form of hemosiderin. After consuming excess iron, there is a large amount of iron deposits in the liver, and the amount ingested is proportional to the severity of iron deposits. Ultrastructure showed that excess iron causes chromatin to accumulate at the edges and mitochondria to swell.

It has been shown that iron overdose in mice can lead to disorder of hepatic hepatocyte cord, Swelling of hepatocytes and infiltration of inflammatory cell (Wang et al., 2015). In our study, histopathological observation of the liver revealed that iron overdose led to disruption of hepatic lobular structures, the presence of a large number of erythrocytes in the central vein, and inflammatory cell infiltration. These phenomena were evident in the shot term after iron excess. In addition, iron is inextricably linked to changes in serum liver function indicator enzymes (Yamada et al., 2020). The ALT and AST are liver damage indicator enzymes released into the blood by damaged hepatocytes (Rinella et al., 2022). In this experiment, serum levels of ALT and AST increased significantly in the initial period after iron overdose and quickly reached a peak. This suggests that iron excess can lead to impaired liver function, leading to increased ALT/AST enzyme activity in the serum. The increase in ALT/AST activity in serum is caused by increased membrane permeability of hepatocytes (Ding et al., 2021), and the permeability of cell membranes also changes during apoptosis. Previous studies have found that the elevation of ALT and AST triggered by excessive arsenic in mouse liver was closely related to apoptosis, which is consistent with the present experiment (Zhong et al., 2021), so we speculate that the increase in ALT/AST may also be related to apoptosis.

Apoptosis is a programmed death process that occurs actively in order to better adapt to the environment, and the apoptotic process is regulated by a variety of genes (Bertheloot et al., 2021). Numerous studies have shown that the mitochondrial pathway plays a key role in apoptosis (Bock and Tait, 2020). The Bax is distributed in the cytoplasm as an inactive monomer and is activated upon receipt of apoptotic signals (Cosentino et al., 2022). The activated Bax migrates to the outer membrane of mitochondria by changing its morphology, thereby disrupting the integrity of the mitochondrial membrane. At the outer mitochondrial membrane, the Bax acts synergistically with Bcl-2, an inhibitor of apoptosis and an integrin of the mitochondrial membrane (Dengler et al., 2021). The Bax and Bcl-2 act as upstream regulatory mechanisms of caspase-3, which activates the caspses cascade and mediates apoptosis (Kulyar et al., 2021). In addition, TNFα binds to its receptor to form a complex that activates downstream Caspase-8 and various effector caspases (Wong et al., 2020). Activated caspases induce a cascade reaction that ultimately triggers apoptosis of target cells (Flores-Romero et al., 2020). It has been shown that cytotoxicity produced by Cu overdose upregulated the expression of Bax and caspase-3 levels, and inhibits the Bcl-2 in chicken hepatocytes, which triggers apoptosis (Yang et al., 2021). It is found that metallic arsenic causes the rise in caspase-3, caspase-9 and Bax to cause apoptosis, which is consistent with this experiment (Wu et al., 2022). In the current study, we found that the expression of Bax, Bak, Caspase-3, caspase-8, and Caspase-9 was significantly activated after iron excess, and the expression of Bcl-2 decreased with the increase of iron overdose. However, this difference began to decrease after a period of iron overdose. This suggests that iron overdose activates caspase-related cascades and the Bcl-2 family, inducing apoptosis in hepatocytes. This conclusion is supported by apoptosis-related phenomena such as cytoplasmic marginal aggregation and mitochondrial swelling in ultrastructural observations.

The PI3K/AKT/mTOR signaling pathway is involved in the regulation of cell growth and survival (Yang et al., 2019). Recent studies have found that activation of apoptotic signaling is closely associated with the PI3K/AKT/mTOR pathway (Du et al., 2022). It is found that ammonium chloride can further increase apoptosis in MAC-T cells through the PI3K/AKT/mTOR signaling pathway (Feng et al., 2021). When the PI3K / AKT pathway was inhibited in human bladder cancer cells, it wasx found that Bcl-2 expression was decreased, and Bax and Caspase-3 expression was significantly increased, which implying that apoptosis could be induced in cancer cells by reducing PI3K / AKT expression levels, thus enhancing cancer amelioration (Lin et al., 2018). It has been reported that mTOR is a stress protein present downstream of PI3K/AKT, which can antagonize each other with PI3K/AKT to participate in apoptosis. The mTOR can trigger apoptosis through the caspase signaling pathway and mediate autophagy through Bcl-2 phosphorylation (Zhou et al., 2020). In the present study, our results showed a significant increase in PI3K and AKT protein levels and a decrease in mTOR protein levels with increasing iron overdose, which is consistent with the trend in gene expression. This is sufficient to demonstrate that iron overldose-induced apoptosis in chicken hepatocytes is associated with activation of PI3K/AKT/mTOR signaling pathway. Activation of PI3K/AKT with inhibition of mTOR reduces apoptosis and thus is involved in the protective effect of iron overload on hepatocytes after damage.

In summary, this study shows that iron deposition caused by excessive iron intake in chicks has a serious damaging effect on the liver and induces apoptosis. At the same time, iron excess can also activate the PI3K/AKT/mTOR axis, which may be involved in the mutual antagonism of apoptosis (Figure. 7).

Ethics approval

All the steps were followed by the welfare regulations of experimental animals. The welfare of all experimental animals and treatment of them are reviewed and approved by Bioethics Committee of the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin, China (Protocol No. 2017005).

Data and model availability statement

The data were not deposited in an official repository. The datasets generated and analysed during the current study are available from the corresponding author upon request.

Author ORCIDs

Fengjiao Sun：https://orcid.org/0000-0003-2046-7209

Yuzhi An：https://orcid.org/0000-0002-9041-4164

Xianglong Lv：https://orcid.org/0000-0002-5901-8139

Ning Sun：https://orcid.org/0000-0003-2717-8098

Xiaoping Lv：https://orcid.org/0000-0002-5296-2418

Chaonan Liu：https://orcid.org/0000-0002-7100-2105

Xueli Gao：https://orcid.org/0000-0002-7887-4328

Author contributions

All authors reviewed the manuscript. FengJiao Sun and Yuzhi An wrote the main manuscript test. Xianglong Lv and Ning Sun finished all the figures. ChaoNan Liu and Xiaoping Lv did all the tables of the result. Xueli Gao conceptualised the paper, provided insights into the entire manuscript and contributed to the writing. All authors read and approved the final manuscript.

Declaration of interest

The authors declare that there is no conflict of interests regarding the publication of this article.

Acknowledgements

We thank the members of the Pathophysiology Laboratory at the College of Veterinary Medicine, Northeast Agricultural University.

Financial support statement

This work was supported by a grant from the National Natural Science Foundation of China (Grant NO.31372355).

Alves, F.M., Kysenius, K., Caldow, M.K., Hardee, J.P., Crouch, P.J., Ayton, S., Bush, A.I., Lynch, G.S., Koopman, R., 2021. Iron accumulation in skeletal muscles of old mice is associated with impaired regeneration after ischaemia-reperfusion damage. J Cachexia Sarcopenia Muscle 12, 476–492. doi:10.1002/jcsm.12685.
Anderson, G.J., Frazer, D.M., 2017. Current understanding of iron homeostasis. Am J Clin Nutr 106, 1559s-1566s. doi:10.3945/ajcn.117.155804.
Ashkenazi, A., Fairbrother, W.J., Leverson, J.D., Souers, A.J., 2017. From basic apoptosis discoveries to advanced selective BCL-2 family inhibitors. Nat Rev Drug Discov 16, 273–284. doi:10.1038/nrd.2016.253.
Battaglioni, S., Benjamin, D., Wälchli, M., Maier, T., Hall, M.N., 2022. mTOR substrate phosphorylation in growth control. Cell 185, 1814–1836. doi:10.1016/j.cell.2022.04.013.
Bertheloot, D., Latz, E., Franklin, B.S., 2021. Necroptosis, pyroptosis and apoptosis: an intricate game of cell death. Cell Mol Immunol 18, 1106–1121. doi:10.1038/s41423-020-00630-3.
Bock, F.J., Tait, S.W.G., 2020. Mitochondria as multifaceted regulators of cell death. Nat Rev Mol Cell Biol 21, 85–100. doi:10.1038/s41580-019-0173-8.
Brenner, C., Galluzzi, L., Kepp, O., Kroemer, G., 2013. Decoding cell death signals in liver inflammation. J Hepatol 59, 583–594. doi:10.1016/j.jhep.2013.03.033.
Chen, M., Zheng, J., Liu, G., Zeng, C., Xu, E., Zhu, W., Anderson, G.J., Chen, H., 2019. High Dietary Iron Disrupts Iron Homeostasis and Induces Amyloid-β and Phospho-τ Expression in the Hippocampus of Adult Wild-Type and APP/PS1 Transgenic Mice. J Nutr 149, 2247–2254. doi:10.1093/jn/nxz168.
Chen, Y., Zhou, X., 2020. Research progress of mTOR inhibitors. Eur J Med Chem 208, 112820. doi:10.1016/j.ejmech.2020.112820.
Cheng, X., Ferrell, J.E., Jr., 2018. Apoptosis propagates through the cytoplasm as trigger waves. Science 361, 607–612. doi:10.1126/science.aah4065.
Cosentino, K., Hertlein, V., Jenner, A., Dellmann, T., Gojkovic, M., Peña-Blanco, A., Dadsena, S., Wajngarten, N., Danial, J.S.H., Thevathasan, J.V., Mund, M., Ries, J., Garcia-Saez, A.J., 2022. The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation. Mol Cell 82, 933–949.e939. doi:10.1016/j.molcel.2022.01.008.
Dengler, M.A., Gibson, L., Adams, J.M., 2021. BAX mitochondrial integration is regulated allosterically by its α1-α2 loop. Cell Death Differ 28, 3270–3281. doi:10.1038/s41418-021-00815-x.
Ding, H., Zhang, Q., Yu, X., Chen, L., Wang, Z., Feng, J., 2021. Lipidomics reveals perturbations in the liver lipid profile of iron-overloaded mice. Metallomics 13 doi:10.1093/mtomcs/mfab057.
Du, A., Li, S., Zhou, Y., Disoma, C., Liao, Y., Zhang, Y., Chen, Z., Yang, Q., Liu, P., Liu, S., Dong, Z., Razzaq, A., Tao, S., Chen, X., Liu, Y., Xu, L., Zhang, Q., Li, S., Peng, J., Xia, Z., 2022. M6A-mediated upregulation of circMDK promotes tumorigenesis and acts as a nanotherapeutic target in hepatocellular carcinoma. Mol Cancer 21, 109. doi:10.1186/s12943-022-01575-z.
Feng, L., Liao, H., Liu, J., Xu, C., Zhong, K., Zhu, H., Guo, S., Guo, Y., Han, L., Li, H., Wang, Y., 2021. Inhibition of PI3K/Akt/mTOR pathway by ammonium chloride induced apoptosis and autophagy in MAC-T cell. Res Vet Sci 136, 622–630. doi:10.1016/j.rvsc.2021.01.020.
Flores-Romero, H., Ros, U., Garcia-Saez, A.J., 2020. Pore formation in regulated cell death. Embo j 39, e105753. doi:10.15252/embj.2020105753.
Gou, Z., Fan, Q., Li, L., Jiang, Z., Lin, X., Cui, X., Wang, Y., Zheng, C., Jiang, S., 2020. Effects of dietary iron on reproductive performance of Chinese Yellow broiler breeder hens during the egg-laying period. Poult Sci 99, 3921–3929. doi:10.3382/ps/pez006.
Gupta, R., Ambasta, R.K., Pravir, K., 2021. Autophagy and apoptosis cascade: which is more prominent in neuronal death? Cell Mol Life Sci 78, 8001–8047. doi:10.1007/s00018-021-04004-4.
Hayes, J.D., Dinkova-Kostova, A.T., Tew, K.D., 2020. Oxidative Stress in Cancer. Cancer Cell 38, 167–197. doi:10.1016/j.ccell.2020.06.001.
Higashi, T., Friedman, S.L., Hoshida, Y., 2017. Hepatic stellate cells as key target in liver fibrosis. Adv Drug Deliv Rev 121, 27–42. doi:10.1016/j.addr.2017.05.007.
Kadam, S., Khaitan, M., Banerjee, P., Mandhare, A., 2021. Ferroportin-inhibitor salt: patent evaluation WO2018192973. Expert Opin Ther Pat 31, 585–595. doi:10.1080/13543776.2021.1928075.
Kulyar, M.F., Yao, W., Ding, Y., Du, H., Li, K., Zhang, L., Li, A., Huachun, P., Waqas, M., Mehmood, K., Li, J., 2021. Cluster of differentiation 147 (CD147) expression is linked with thiram induced chondrocyte's apoptosis via Bcl-2/Bax/Caspase-3 signalling in tibial growth plate under chlorogenic acid repercussion. Ecotoxicol Environ Saf 213, 112059. doi:10.1016/j.ecoenv.2021.112059.
Labranche, R., Gilbert, G., Cerny, M., Vu, K.N., Soulières, D., Olivié, D., Billiard, J.S., Yokoo, T., Tang, A., 2018. Liver Iron Quantification with MR Imaging: A Primer for Radiologists. Radiographics 38, 392–412. doi:10.1148/rg.2018170079.
Li, M., Zhou, X., Mei, J., Geng, X., Zhou, Y., Zhang, W., Xu, C., 2014. Study on the activity of the signaling pathways regulating hepatocytes from G0 phase into G1 phase during rat liver regeneration. Cell Mol Biol Lett 19, 181–200. doi:10.2478/s11658-014-0188-2.
Li, Y., Xia, J., Jiang, N., Xian, Y., Ju, H., Wei, Y., Zhang, X., 2018. Corin protects H(2)O(2)-induced apoptosis through PI3K/AKT and NF-κB pathway in cardiomyocytes. Biomed Pharmacother 97, 594–599. doi:10.1016/j.biopha.2017.10.090.
Lin, W., Xie, J., Xu, N., Huang, L., Xu, A., Li, H., Li, C., Gao, Y., Watanabe, M., Liu, C., Huang, P., 2018. Glaucocalyxin A induces G2/M cell cycle arrest and apoptosis through the PI3K/Akt pathway in human bladder cancer cells. Int J Biol Sci 14, 418–426. doi:10.7150/ijbs.23602.
Liu, X., Zhao, J., Zhang, L., Lu, J., Lv, X., Liu, C., Gao, X., 2020. Effects of Different Doses of Excessive Iron in Diets on Oxidative Stress in Immune Organs of Sheep. Biol Trace Elem Res 197, 475–486. doi:10.1007/s12011-019-02006-9.
Lu, L., Dong, X., Ma, X., Zhang, L., Li, S., Luo, X., Liao, X., 2022. Metabolic utilization of intravenously injected iron from different iron sources in target tissues of broiler chickens. Anim Nutr 9, 74–83. doi:10.1016/j.aninu.2021.06.018.
Ma, S., Dubin, A.E., Zhang, Y., Mousavi, S.A.R., Wang, Y., Coombs, A.M., Loud, M., Andolfo, I., Patapoutian, A., 2021. A role of PIEZO1 in iron metabolism in mice and humans. Cell 184, 969–982.e913. doi:10.1016/j.cell.2021.01.024.
Mancardi, D., Mezzanotte, M., Arrigo, E., Barinotti, A., Roetto, A., 2021. Iron Overload, Oxidative Stress, and Ferroptosis in the Failing Heart and Liver. Antioxidants (Basel) 10 doi:10.3390/antiox10121864.
Nagata, S., 2018. Apoptosis and Clearance of Apoptotic Cells. Annu Rev Immunol 36, 489–517. doi:10.1146/annurev-immunol-042617-053010.
Prokhorova, E.A., Zamaraev, A.V., Kopeina, G.S., Zhivotovsky, B., Lavrik, I.N., 2015. Role of the nucleus in apoptosis: signaling and execution. Cell Mol Life Sci 72, 4593–4612. doi:10.1007/s00018-015-2031-y.
Protchenko, O., Baratz, E., Jadhav, S., Li, F., Shakoury-Elizeh, M., Gavrilova, O., Ghosh, M.C., Cox, J.E., Maschek, J.A., Tyurin, V.A., Tyurina, Y.Y., Bayir, H., Aron, A.T., Chang, C.J., Kagan, V.E., Philpott, C.C., 2021. Iron Chaperone Poly rC Binding Protein 1 Protects Mouse Liver From Lipid Peroxidation and Steatosis. Hepatology 73, 1176–1193. doi:10.1002/hep.31328.
Riegman, M., Sagie, L., Galed, C., Levin, T., Steinberg, N., Dixon, S.J., Wiesner, U., Bradbury, M.S., Niethammer, P., Zaritsky, A., Overholtzer, M., 2020. Ferroptosis occurs through an osmotic mechanism and propagates independently of cell rupture. Nat Cell Biol 22, 1042–1048. doi:10.1038/s41556-020-0565-1.
Rinella, M.E., Dufour, J.F., Anstee, Q.M., Goodman, Z., Younossi, Z., Harrison, S.A., Loomba, R., Sanyal, A.J., Bonacci, M., Trylesinski, A., Natha, M., Shringarpure, R., Granston, T., Venugopal, A., Ratziu, V., 2022. Non-invasive evaluation of response to obeticholic acid in patients with NASH: Results from the REGENERATE study. J Hepatol 76, 536–548. doi:10.1016/j.jhep.2021.10.029.
Sarlak, S., Tabeidian, S.A., Toghyani, M., Shahraki, A.D.F., Goli, M., Habibian, M., 2021. Effects of Replacing Inorganic with Organic Iron on Performance, Egg Quality, Serum and Egg Yolk Lipids, Antioxidant Status, and Iron Accumulation in Eggs of Laying Hens. Biol Trace Elem Res 199, 1986–1999. doi:10.1007/s12011-020-02284-8.
Shojaie, L., Iorga, A., Dara, L., 2020. Cell Death in Liver Diseases: A Review. Int J Mol Sci 21 doi:10.3390/ijms21249682.
Su, L.J., Zhang, J.H., Gomez, H., Murugan, R., Hong, X., Xu, D., Jiang, F., Peng, Z.Y., 2019. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxid Med Cell Longev 2019, 5080843. doi:10.1155/2019/5080843.
Tewari, D., Patni, P., Bishayee, A., Sah, A.N., Bishayee, A., 2022. Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. Semin Cancer Biol 80, 1–17. doi:10.1016/j.semcancer.2019.12.008.
Torti, S.V., Torti, F.M., 2013. Iron and cancer: more ore to be mined. Nat Rev Cancer 13, 342–355. doi:10.1038/nrc3495.
Ueno, T., Komatsu, M., 2017. Autophagy in the liver: functions in health and disease. Nat Rev Gastroenterol Hepatol 14, 170–184. doi:10.1038/nrgastro.2016.185.
Unzu, C., Planet, E., Brandenberg, N., Fusil, F., Cassano, M., Perez-Vargas, J., Friedli, M., Cosset, F.L., Lutolf, M.P., Wildhaber, B.E., Trono, D., 2019. Pharmacological Induction of a Progenitor State for the Efficient Expansion of Primary Human Hepatocytes. Hepatology 69, 2214–2231. doi:10.1002/hep.30425.
Wang, M., Liu, R.R., Wang, C.J., Kang, W., Yang, G.H., Zhong, W.N., Lai, Y.R., 2015. Combined histological and hematological assessment of iron-induced organ damage in a gerbil model of iron overload. Am J Transl Res 7, 385–392.
Wong, J., Garcia-Carbonell, R., Zelic, M., Ho, S.B., Boland, B.S., Yao, S.J., Desai, S.A., Das, S., Planell, N., Harris, P.A., Font-Burgada, J., Taniguchi, K., Bertin, J., Salas, A., Pasparakis, M., Gough, P.J., Kelliher, M., Karin, M., Guma, M., 2020. RIPK1 Mediates TNF-Induced Intestinal Crypt Apoptosis During Chronic NF-κB Activation. Cell Mol Gastroenterol Hepatol 9, 295–312. doi:10.1016/j.jcmgh.2019.10.002.
Wu, L., Yang, F., Du, S., Hu, T., Wei, S., Wang, G., Zeng, Q., Luo, P., 2022. Inorganic arsenic promotes apoptosis of human immortal keratinocytes through the TGF-β1/ERK signaling pathway. Environ Toxicol 37, 1321–1331. doi:10.1002/tox.23486.
Yamada, N., Karasawa, T., Kimura, H., Watanabe, S., Komada, T., Kamata, R., Sampilvanjil, A., Ito, J., Nakagawa, K., Kuwata, H., Hara, S., Mizuta, K., Sakuma, Y., Sata, N., Takahashi, M., 2020. Ferroptosis driven by radical oxidation of n-6 polyunsaturated fatty acids mediates acetaminophen-induced acute liver failure. Cell Death Dis 11, 144. doi:10.1038/s41419-020-2334-2.
Yang, F., Liao, J., Yu, W., Qiao, N., Guo, J., Han, Q., Li, Y., Hu, L., Pan, J., Tang, Z., 2021. Exposure to copper induces mitochondria-mediated apoptosis by inhibiting mitophagy and the PINK1/parkin pathway in chicken (Gallus gallus) livers. J Hazard Mater 408, 124888. doi:10.1016/j.jhazmat.2020.124888.
Yang, J., Nie, J., Ma, X., Wei, Y., Peng, Y., Wei, X., 2019. Targeting PI3K in cancer: mechanisms and advances in clinical trials. Mol Cancer 18, 26. doi:10.1186/s12943-019-0954-x.
Yu, Y., Jiang, L., Wang, H., Shen, Z., Cheng, Q., Zhang, P., Wang, J., Wu, Q., Fang, X., Duan, L., Wang, S., Wang, K., An, P., Shao, T., Chung, R.T., Zheng, S., Min, J., Wang, F., 2020. Hepatic transferrin plays a role in systemic iron homeostasis and liver ferroptosis. Blood 136, 726–739. doi:10.1182/blood.2019002907.
Zheng, X., Li, W., Xu, H., Liu, J., Ren, L., Yang, Y., Li, S., Wang, J., Ji, T., Du, G., 2021. Sinomenine ester derivative inhibits glioblastoma by inducing mitochondria-dependent apoptosis and autophagy by PI3K/AKT/mTOR and AMPK/mTOR pathway. Acta Pharm Sin B 11, 3465–3480. doi:10.1016/j.apsb.2021.05.027.
Zhong, G., Wan, F., Wu, S., Jiang, X., Tang, Z., Zhang, X., Huang, R., Hu, L., 2021. Arsenic or/and antimony induced mitophagy and apoptosis associated with metabolic abnormalities and oxidative stress in the liver of mice. Sci Total Environ 777, 146082. doi:10.1016/j.scitotenv.2021.146082.
Zhou, B., Zhang, J.Y., Liu, X.S., Chen, H.Z., Ai, Y.L., Cheng, K., Sun, R.Y., Zhou, D., Han, J., Wu, Q., 2018. Tom20 senses iron-activated ROS signaling to promote melanoma cell pyroptosis. Cell Res 28, 1171–1185. doi:10.1038/s41422-018-0090-y.
Zhou, J., Jiang, Y.Y., Chen, H., Wu, Y.C., Zhang, L., 2020. Tanshinone I attenuates the malignant biological properties of ovarian cancer by inducing apoptosis and autophagy via the inactivation of PI3K/AKT/mTOR pathway. Cell Prolif 53, e12739. doi:10.1111/cpr.12739.

Download PDF

Version 1

posted

You are reading this latest preprint version

Excess Iron added to the diet induces the apoptosis of chicken’s liver through the PI3KAKT mTOR axis

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals and Diets

Pathological Observations

Iron Analysis

Western Blotting Analysis

Statistical Analysis

Results

Histopathological Observation of the Liver

Iron Content of the Liver

Changes in Enzyme Activity

mRNA Expression of Apoptosis Related Genes in Liver

mRNA Expression of PI3K/AKT/mTOR Pathway Related Genes in Liver

Western Bolt Analysis of PI3K/AKT/mTOR Levels

Discussion

Conclusion

Declarations

References

Status:

Version 1