5.1. Cells Culture
Eca109 cells were purchased from Procell (China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, Gemini BioProducts, Woodland, CA, USA) and 1% penicillin/streptomycin (Beyotime Biotechnology, Shanghai, China), and 0.03% L-glutamine. The temperature was 37°C in a humid environment with 5% CO2. The medium was changed every three days.
5.2. RNA Interference and Plasmid Transfection
The small interfering RNA (siRNA) of TRIM56 was designed and synthesized by GenePharma (Shanghai, China). The above siRNA fragments were transfected into Eca109 cells using LipofectamineTM 2000 Transfection Reagent (Invitrogen, USA) according to the manufacturer's manuals. The above cells were further analyzed at 72h after transfection.
5.3. Western Blot (WB)
The cellular protein was extracted from Eca109 cell samples, used 10% SDS polyacrylamide gel electrophoresis (PAGE), and moved to PVDF membranes. After blocking with 5% skimmed milk, samples were probed with primary antibodiesTRIM56, LC3B, P62, V5 and control glyceraldehyde-3- phosphate dehydrogenase (GAPDH), and their suitable HRP-tagged secondary antibodies (mouse or rabbit). After washing three times in TBST, western bands were exposed to the Automatic chemiluminescence image analyzer system (Yuwei Biotechnology, Guangzhou
, China) .
5.4. Quantitative real-time PCR (qRT-PCR)
Total RNAs were isolated f Eca109 cell samples by using the Trizol reagent. Synthesize cDNA according to the product specification. Use SYBR Green PCR Master Mix to quantify RNA expression in a real-time PCR system. Adopt the comparison 2−∆∆Ct method to calculate gene expression, and β-actin was used as an internal control. Each experiment was repeated three times.
β-actin, forward:AGCGAGCATCCCCCAAAGTT;reverse:GGGCACGAAGGCTCATCATT. TRIM56, forward:CTGCTTGGMGACTTCCTGAC, reverse:GTGGATGGTSCCGTTACTGAG. LC3BⅡ, forward:GATACAAGGGTGAGAAGCAG, reverse:CGTTCACCAACAGGAAGAAG. P62, forward:CCAGGACAGCGAGAGGAAGG, reverse:CTCTCACTTGGATTACAGGCGTAGG. ATG12, forward:CTGCTGGCGACACCAAGAAA, reverse:CGTGTTCGCTCTACTGCCC. FOXO4, forward:CCGGAGAAGCGACTGACAC, reverse:CGGATCGAGTTCTTCCATCCTG. PIK3CB, forward:ATCGCTCTGGCCTCATTGAAGTTG,
reverse: ATGGCTCGGTCCAGGTCATCC.
5.5. Immunohistochemistry
Esophageal squamous cell carcinoma tissues and normal esophageal mucosal tissues were made into paraffin sections, deparaffinized with xylene, and rehydrated with ethanol. The above sections were boiled in antigenic repair solution using the pressure cook for 15 minutes. Some sections were stained with H&E, and others were covered with TRIM56 antibody (1:100), placed in a refrigerator at 4°C for overnight incubation, and incubated with secondary antibody at room temperature for 15 minutes. Finally, diaminobenzidine staining was performed. The above sections were imaged under a Leica DMIL FL fluorescence inverted microscope (Leica, Wetzlar, Germany) after hematoxylin counterstaining, alcohol dehydration and cleaning in xylene. PBS buffer was used instead of primary antibody for negative control. Ten fields (×40) were randomly observed in each section, and the double scoring method was used to determine (Terpc et al., 1996), which was determined according to the proportion of positive cells and the degree of staining. The score criteria of cell staining degree were as follows: no staining was (0 points), light yellow was (1 point), brown yellow was (2 points), and tan was (3 points). The proportion of positive cells in the visual field was scored as follows: the number of positive cells was less than 5% (0 points), 5%-25% (1 point), 26%-50% (2 points), 51%-75% (3 points), and more than 75% (4 points). Product ≤1 is negative (-), 2-4 is (+), 5-7 is (+++), ≥8 is (+++), where +- +++ + indicates increasing positive expression. The study was approved by the Ethical Committee of Youjiang Medical University for Nationalities.
5.6. Immunofluorescence (IF)
First, place the Eca109 cell samples on the culture slide in phosphate-buffered saline (PBS) washed three times, then fixed and in the serum of the same host as the secondary antibody. The primary antibody against LC3B and the secondary antibody are used in sequence and rinsed three times with PBS. After staining with DAPI, the cell nucleus was detected, and finally, the samples were exposed to a confocal imaging system (Olympus, Tokyo, Japan).
5.7. Statistical analysis
SPSS18.0 statistical software was used to analyze the expression of TRIM56 protein in esophageal squamous cell carcinoma and normal esophageal tissues and to explore its roles in the infiltration and metastasis of cancer. All experiments were repeated at least three times. The data were expressed as mean ± SD and compared with independent-samples t-test and one-way ANOVA.P-values <0.05 were considered statistically significant.