Plant material
Ceratonia siliquapods (carob) were purchased from a local herbal market and were identified by the staff members of the Department of Flora, Ministry of Agriculture, Giza, Egypt.. A voucher sample was kept in the Pharmacology Department, Faculty of Veterinary Medicine, Cairo University. The seeds of the dried pods were removed and the carob pulps were powdered in an electric blender. Two hundred grams of the dried powder were extracted with methanol 95% for 24 hours, followed by percolation 5–7 times till complete extraction. The methanol extract was concentrated under reduced pressure at low temperature and reserved at – 4°C until subsequent use. The extract was freshly suspended in sterile phosphate buffer saline (pH 7.2) to a final concentration of 200 mg/ml.
Acute Toxicity Testing
Twenty mice were allocated randomly into 4 groups of 5 mice each. Before testing, the animals were fasted for 12 hrs (Atta et al. 2017) but allowed free access to drinking water. Rats in groups A, B, C and D were orally administered 0.5, 1, 2 and 4g/kg b. wt. of the carob pulps methanol extract, respectively. Mortality and symptoms of toxicity such as jerks and writhes were observed over 24 hours and daily up to 5 days.
Phytochemistry
Gas Chromatography (Agilent Technologies 7890A) interfaced with a mass selective detector (Agilent 7000 Triple Quad) and Agilent HP-5ms capillary column (30 m×0.25 mm ID and 0.25 µm film thickness) were used. The temperatures of the injector and the detector were adjusted to 200°C and 250°C, respectively. The flow rate was 1 mL/min. The acquisition mass range was 50–600. The formulae of the components as identified by comparing their mass spectra and RT with those of NIST and WILEY library were recorded.
Animals, treatments and sampling
Thirty-five Wistar rats of 200–250 g body weight were obtained from Animal Breeding House, national Research centre, Giza, Egypt. Animals were reared under strict hygienic conditions for 7 days for acclimatization. Animals were randomly allocated into 5 equal groups. Rats of the first and second group were given normal saline (1mL/rat) orally by gastric gavage for 5 days. Rats of the third group were given Vitamin C (reference antioxidant drug) in a dose of 250 mg/kg b. wt. by oral route. Rats in the fourth and fifth groups were given CME at a dose 500 and 1000 mg/kg b. wt. respectively by the same route for the same period. In the fifth day, rats of groups 2–5 were given DOX at a dose of 15 mg/kg intraperitoneal (IP), 1 hour after the last treatment dose (Ibrahim et al. 2019). After 48 hrs, body weight was recorded and samples of blood were taken from retro orbital plexus of veins under light anaesthesia. Blood samples were left to clot to obtain clear serum after centrifugation (4000 rpm for 10 min). Serum was maintained at -20°C for estimation of kidney function parameters (creatinine, urea, calcium, potassium, sodium and chloride). Rats were then euthanized with pentobarbital sodium (150 mg/kg b. wt. IP). Both kidneys were removed from all rats, weighted and were used for preparation of tissue homogenate, immunohistochemistry and histopathology.
The kidneys were dissected and washed with PBS (10 mM (10 mM KH2PO4, 8 mM NaH2PO4−,137 mM NaCl, 2.7 mM KCl; pH = 7.4). The kidney tissues were then blended in PBS and centrifuged at 10,000×g for 20 min at 4°C. The supernatant was kept at -80ºC till used for assessment of oxidative stress, inflammatory and immune responses and apoptotic markers.
Assessment Of Nephrotoxicity Indices In Serum
Serum creatinine and urea levels were estimated using kits purchased from Erba, Germany. Serum sodium, potassium, chloride, and calcium levels were determined using kits purchased from Centronic Company, Germany.
Assessment Of Oxidative Stress Markers In Kidney Homogenate
Reduced glutathione (GSH) concentration (Ellman 1959) and the activities of superoxide dismutase (SOD) (Marklund & Marklund 1974), glutathione-S-transferase (GST) (Habig et al. 1974), and Lipid peroxide by-product as malondialdhyde (MDA) contents (Ohkawa et al. 1979) were estimated in the supernatant of kidney homogenate. All Analytical chemicals were purchased from Sigma Alderish, USA. The concentration of MDA was estimated using commercial test kit obtained from Biodiagnostic Co, Egypt. These parameters were estimated using a spectrophotometer (T80 UV/VIS PG instrument Ltd, UK), Catalase (CAT) and myeloperoxidase (MPO) activities were assessed by ELISA using the commercially available kit (SUNLONG, China).
Assessment Of Inflammatory, Immune Response And Apoptotic Markers In Kidney Tissue Homogenate
The pro-inflammatory cytokines; the interleukin-6 (IL-6) and the tumor necrosis factor alpha (TNF-α) were estimated by ELISA using commercially available kits (SUNLONG, China) and (Cloud Clone Crop, China), respectively. The levels of the anti-inflammatory mediators; interleukin-10 (IL-10) and transforming growth factor-β (TGF-β) were also determined by ELISA using the commercially available kits (SUNLONG, China). The apoptotic marker; Caspase-3 (Cas-3) was assessed by ELISA using the commercial kits from SUNRED, China. In brief, kidney tissue homogenates were incubated with the immobilized specific antibodies and visualized using HRP-TMB reaction.
Real-time Pcr For Assessment Of Gene Expression
The transcript level of COX-2, Cas-9, Bax and Bcl-2 was assessed by the R-T PCR. Total RNA of the kidney tissue was extracted using EasyRNA™ Cell/Tissue RNA Mini Kit (Biovision #K1337). The synthesis of the first-strand cDNA was carried out using SuperScript Reverse Transcriptases (Thermoscientific) according to the instructions of the manufacturer. Quantitative PCR was performed using Power Track™ SYBR Green Master Mix Applied Biosystems™ on an ABI Prism Step OnePlus Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions. The primer sets of the assessed genes were listed in Table 1. The relative mRNA expression of the target genes was calculated as fold change of the normal control after normalization to actb, reference transcript, using 2 − ΔΔCT methods.
Table 1
The primer sets of the assessed genes
Gene | Forward primer | Reverse primer | Product | Accession No. |
cas-9 | CTGTGTTCCAAGGTCTCGGC | CCAGGCTCACTTAGCAAGGAA | 149 | NM_031632.2 |
bax | CACGTCTGCGGGGAGTCAC | TTCTTGGTGGATGCGTCCTG | 248 | NM_017059.2 |
Bcl-2 | TCGCGACTTTGCAGAGATGT | CAATCCTCCCCCAGTTCACC | 116 | NM_016993.2 |
cox-2 | CTCAGCCATGCAGCAAATCC | GGGTGGGCTTCAGCAGTAAT | 172 | NM_017232.3 |
actb | CCGCGAGTACAACCTTCTTG | CAGTTGGTGACAATGCCGTG | 297 | NM_031144.3 |
Immunohistochemistry And Histopathology
B-cell lymphoma-2 protein-associated X protein (Bax), B-cell lymphoma-2 protein (Bcl-2), cycloxigenase-2 (COX-2), and nuclear factor kappa (NF-κβ) were immunohistochemically stained in paraffin-embedded tissue sections after antigen retrieval using citrate buffer (pH 6). Primary antibodies against Bax (InVitrogen PA5-78857, USA), Bcl-2 (InVitrogen PA5-27094, USA), COX-2 (InVitrogen PA1-37505, USA), and NF-κβ P65 (sc-8008, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) were applied to the slides, followed by endogenous peroxidase blocking by hydrogen peroxide. Secondary horseradish peroxidase (HRP)-labeled antibody was applied according to the protocol of the manufacturer (Universal PolyHRP DAB kit for mouse and rabbit, Genemed, Sakura Torrance, CA, USA). Secondary antibodies were used without primary antibodies in the negative control slides.
Kidney specimens were fixed in 10% neutral buffered formalin. Fixed tissue was dehydrated in ascending concentrations of ethanol, cleared in xylene and embedded in paraffin. The tissue was sectioned by microtome (Lieca 2135, Germany) into 4 µm thickness sections and stained by hematoxylin and eosin stain. Light microscope (Olympus BX43, Japan) equipped by digital camera (Olympus DP27 camera) was used for examination.
Statistics
Data were presented as mean ± SD. Difference between means of different groups were tested for significance using one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test via IBM SPSS (IBM Corporation, Armonk, NY, USA. The difference was considered significant at P < 0.05.