Animals
Forty 18-month-old Sprague Dawley (SD) rats were purchased from Beijing Sibeifu Biotechnology Co., Ltd. (Beijing, China). Rats were housed in a room with a 12-hour light/dark cycle and free access to water and food. The room temperature was controlled at 23-25℃. All of the animal experiments were approved by the Institutional Animal Research Ethics Committee of Beijing Rehabilitation Hospital (Approval No. 2021bkky018).
Experimental Design
All rats were randomly divided into four groups: cognitive intervention (CI) group, exercise intervention (EI) group, dual-task intervention (DI) group, and aged control (AC) group, with 10 rats in each group, half male and half female.( Computerized random number generation) The four groups of rats were treated with intervention according to the method previously reported by our group (Cognitive–exercise Dual-task Intervention Ameliorates Cognitive Decline in Natural Aging Rats Through Reducing Oxidative Stress and Enhancing Synaptic Plasticity). The CI group performed attention box training and the EI group performed running wheel training. The DI group performed both tasks simultaneously, while the AC group does not perform any tasks. The rats in the CI group were subjected to a 20% caloric restriction at the start of CI. The rats in the CI group were placed in a Skinner box that measured 360 mm in length, 265 mm in width, and 325 mm in height. On one wall, there was a pellet dispenser, and on the opposite wall, there were five nasal contacts with infrared probes and built-in indicator lights. The indicator light was turned on at random and automatically turned off after 10 seconds. The rats were trained to receive one food pellet if they touched the nasal contact with their nose within 10 seconds of the light being turned on. If they did not make contact with the nasal contact within 10 seconds of the light being turned on, the light would go out and the rats would receive nothing. Rats in the EI group underwent a preparatory experiment before the formal EI. The preparatory experiment determined the appropriate exercise intensity for older rats. Individually seated in a running wheel with a diameter of 355 mm, the rats in the EI group underwent passive activity at a speed of two circles per minute. The CI and EI were administered simultaneously to the DI group of rats. The duration of each intervention was 12 weeks, with five 10-minute sessions per week. The four rat groups were tested on their learning and memory skills using the novel object recognition (NOR) test after 12 weeks. The interventions continued until the end of the behavioral test. Euthanasia of rats by intraperitoneal injection of sodium pentobarbital 200 mg/kg. The expression of relevant pathway proteins, LncRNA, and miRNA was then examined in the hippocampus using Western blotting (WB) and Real-time Quantitative PCR.
Novel Object Recognition Test
A large open test box (830mm long x 580mm wide x 510mm high) was placed in a quiet room with a low-wattage light bulb. All rats were put into the empty test box in turn for 10 minutes to be familiarized with the environment for 3 consecutive days. In the first part of the experiment (TI), two identical objects were placed in two corners on the same side of the test box, and the rat was allowed to explore for 5 min. In the second part of the experiment (T2), one object was replaced with another object of a different shape, and the rat was allowed to explore for 5 min. Effective detection was defined as pointing the nose at an object at a distance of less than 2cm and/or touching the object with the nose. Turning around or sitting on the object was not considered an exploration.
The time to explore familiar and novel objects in T2 is denoted by F and N, respectively Discrimination index = (N - F) / (N + F) × 100%.
Cell Culture and plasmid transfection
The HT22 mouse hippocampal neuronal cells were cultured in DMEM containing 1% double antibodies, and 10% FBS, at 37℃. 5% CO2 was maintained in saturated humidity, and the cells were routinely passaged at approximately 80% cell density. The expression changes of caveolin1/PI3K/Akt/GSK3β pathway proteins were observed by transfecting shNEAT1, miR-124-3p mimics, and miR-124-3p Inhibitor into neuronal cells to interfere with the expression of LncRNA NEAT1 and miRNA-124-3p, respectively.
HT22 cells were spread at a density of 4×10^5 to 8×10^5 cells/cm^2 on a 10 cm cell culture dish and incubated in a 37 ℃ incubator with 5% CO2 for 8-24 h. Transfection was started after complete cell wall attachment. After transfection, the medium was incubated in a 37 ℃ incubator with 5% CO2 for 8-12 h. The medium was replaced with serum-containing medium pre-warmed at 37℃ and continued to incubate for 48 h. The lncRNA shNEAT1 and miR-124-3p mimics, and miR-124-3p inhibitor primer sequences are shown in Table 1.
Western Blot
After collecting the cells and rat hippocampal tissue for lysis and centrifugation, the supernatants were collected and the protein concentrations were detected by using a BCA protein Assay kit. Protein extracts were resolved by SDS- PAGE and transferred to PVDF membranes. The PVDF membranes were blocked at room temperature for 1 h, followed by 1 wash with TBST. The primary antibody diluted to the appropriate concentration was placed into the PVDF membrane overnight at 4 ℃, then washed 3 times with TBST and 1 with double-distilled water. Then, the PVDF membranes were incubated with a secondary antibody labeled with Horseradish peroxidase (HRP) at room temperature for 1 h. Finally, the membranes were washed 5 times with TBST and washed 1 with double-distilled water before detection by using Western chemiluminescent HRP substrate. The protein levels were analyzed using ImageJ software. The primary antibodies: Anti-caveolin-1 (1:1000; Abcam; ab32577), Anti-P-AKT (1:000; CST; 40160), Anti-P-PI3k (1:000; affinity; AF4372), Anti-P-GSK3β (1:1000; CST; 5558S).
Reverse Transcription Real-time Quantitative Polymerase Chain Reaction (RT-qPCR)
Total RNA was extracted from cells and rat brain tissue and reverse transcribed using RevertAid First Strand cDNA Synthesis Kit. cDNA obtained by reverse transcription, specific primers(Table2), and 2×UltraSYBR Mixture were used in a 20ul reaction system according to 2×UltraSYBR Mixture 10 µL, Primers (Tabe (F/R mix) 2 µL (0.2 µM), cDNA 8 µL. Reaction conditions were: 10minute at 95°C, then 40 cycles of 15 seconds at 95°C and 20 seconds at 60°C and 25 seconds at 72°C, and finally 5 minutes at 72°C.
statistical analysis
The data were analyzed by IBM SPSS Statistics 20 and were expressed as the mean ± SEM. The normality of indicators was tested. One-way ANOVA (four groups) was employed if the data fit a normal distribution; otherwise, a non-parametric Kruskal-Wallis test was applied. When p<0.05, differences were deemed significant.
Table 1
Primers used for reporter gene vector
|
Sense (5’-3’)
|
shNEAT1(mus)-1
|
GGAGGAATCTTCCTTAGATGG
|
mmu-miRNA-124-3p mimics
|
UAAGGCACGCGGUGAAUGCC
|
mmu-miRNA-124-3p inhibitor
|
GGCAUUCACCGCGUGCCUUA
|
Table 2
Primer sets used for qPCR.
|
Forward primer (5′-3′)
|
Reverse primer (5′-3′)
|
NEAT1
|
CCCCACACCTCTGCTAATGT
|
CTTCTGCCCTTTGGCTACAG
|
miR-124-3p
|
TAAGGCACGCGGTG
|
CAGTGCAGGGTCCGAGGTAT
|