Hepatocyte-Derived Exosomal microRNAs Orchestrate Vascular Inflammation and Endothelial Function: Insights Into Molecular Mechanisms of Trimethylamine-N-Oxide in Atherosclerosis

doi:10.21203/rs.3.rs-223231/v1

Download PDF

Research

Hepatocyte-Derived Exosomal microRNAs Orchestrate Vascular Inflammation and Endothelial Function: Insights Into Molecular Mechanisms of Trimethylamine-N-Oxide in Atherosclerosis

https://doi.org/10.21203/rs.3.rs-223231/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

Trimethylamine-N-oxide (TMAO) has been proved to be a new proatherogenic compound for promoting vascular inflammation and endothelial dysfunction. Hepatocyte-derived exosomes played an important role in the regulation of vascular inflammation and endothelial function. Since TMAO is produced in the liver, hepatocytes may be the first potential target of TMAO. However, it is not clear whether TMAO can directly stimulate normal hepatocytes to produce exosomes so as to mediate the motivating effects of TMAO on inflammation and endothelial dysfunction.

Methods

The hepatocytes were cultured and treated with TMAO at a physiological concentration for 24 hours (TMAO-Exos). The untreated group served as the control (Control-Exos). The exosomes were isolated from the culture supernatant and then added to the human aortic endothelial cells (HAECs) for 48 hours. The mRNA expressions of inflammatory cytokines and caspase-3 were determined by qPCR and cell apoptosis was evaluated by using the Hoechst 33342 staining solution. The miRNA profile in the exosomes were detected using an RNA-sequencing strategy. The miRNA-mRNA network was predicted, and the biological functions of the target genes were annotated by using bioinformatics methods.

Results

TMAO-Exos were able to promote the expressions of inflammatory cytokines and HAECs apoptosis. Moreover, miRNAs carried by the TMAO-Exos were quite different from that in the Control-Exos, including miR-92a-3p, miR-103-3p and miR-122-5p, etc. Further analysis showed that these differentially expressed miRNAs were predicted to target genes such as Mapk8, Casp9, Mapk10, Bcl2l11, Ikbkg and Akt1, which were supposed to be involved in the signal pathways related to vascular inflammation and endothelial function.

Conclusions

These novel results provided evidence that TMAO could indirectly talk to vascular endothelial via promoting hepatocytes to secreting exosomes that carried important genetic information, which may give a new insight into the interactions between liver and vasculature in the atherogenesis caused by TMAO. New intervention targeting this cellular crosstalk may be feasible and effective in the prevention and treatment of TMAO-induced atherogenesis.

Translational Medicine

Hepatocyte-derived

Vascular Inflammation

Endothelial Function

Atherosclerosis

Ischemic heart disease remains a major long-term public health challenge around the world [1]. Chronic vascular inflammation and endothelial dysfunction clearly represent the characteristics of atherosclerosis [2]. In recent years, trimethylamine-N-oxide (TMAO) has been proved to be a proatherogenic compound, for exerting its pathogenic effects via promoting vascular inflammation and endothelial dysfunction [3-5]. However, the molecular mechanisms have not been completely explained.

Exosomes are nanosized membrane particles with a 50 to 100 nm size range, which are secreted by various types of cells and transmit information from cells to cells. The functions and characteristics of exosomes mainly depend on the types and states of the host cells from which they are originated. There are many kinds of proteins, lipids, microRNAs (miRNAs) and other non-coding RNAs carried by exosomes, which were considered as the key materials for intercellular communications and play a crucial regulatory role in many biological processes such as immune response, cardiovascular disease, tumor, and neurodegenerative disease [6-8].

The latest studied indicated that hepatocyte-derived exosomes played an important role in the regulation of vascular inflammation and endothelial function [9, 10]. Since TMAO is produced in the liver [11], hepatocytes may be the first potential target of TMAO. In fact, recent research has indicated that TMAO could work directly on hepatocytes and thus exerting its influence over metabolic syndrome [12]. However, it is not clear whether TMAO can directly stimulate hepatocytes to produce exosomes so as to mediate the motivating effects of TMAO on inflammation and endothelial dysfunction.

In the present research, TMAO was found to directly stimulate normal hepatocytes to release exosomes and thus inducing inflammation activation and cell apoptosis. Next, we utilized an RNA-sequencing strategy to characterize the miRNAs candidates contained in the exosomes, and further analysis revealed that the differentially expressed miRNAs were predicted to target the potential genes which were involved in vascular inflammation and endothelial dysfunction. These novel results provided evidence that TMAO could indirectly talk to vascular endothelial via promoting hepatocytes to secreting exosomes that carried important genetic information, which may give a new insight into the interactions between liver and vasculature in the atherogenesis caused by TMAO. Therefore, new intervention targeting this cellular crosstalk may be feasible and effective in the prevention and treatment of TMAO-induced atherogenesis.

AML12 cells culture, treatment, exosomes isolation and characterization

The AML12 cells (iCell Bioscience Inc, Shanghai) were cultured in DMEM/F12 (iCell Bioscience Inc, Shanghai) containing exosome-depleted serum (C38010050, ViVaCell, Shanghai), and treated with TMAO (T1362, Tokyo Chemical Industry Co., Ltd.) at a physiological concentration of 50 μmol/L (TMAO-Exos). The untreated group served as control (Control-Exos). After 24 hours, exosomes were isolated and purified from the culture supernatant using differential centrifugation. Briefly, the medium was collected and centrifuged at 300×g for 10min, 2000×g for 10min at 4℃ and then again at 10000×g for 30 min at 4℃. The supernatant was then passed through a 0.22-mm filter (Millipore) and ultracentrifuged at 110000×g for 70 min at 4℃. The pellets were then washed with phosphate-buffered saline (PBS) followed by a second ultracentrifugation at 110000×g for 70 min at 4℃ and then resuspended in PBS. The protein levels of the exosomes were measured using a BCA protein assay kit (23228, Thermo Scientific). The ultrastructure and size distribution of the exosomes were identified by transmission electron microscopy (JEM1200-EX, Japan) and nanoparticle tracking analysis (Nanosight NS300, Malvern, UK) respectively. Protein marker of CD81 (Servicebio, Wuhan, China) was detected by western blotting. Exosomes were labelled with DiI (Beyotime Biotechnology) for in vitro tracer experiment.

Endothelial cells culture and treatment

Human aortic endothelial cells (HAECs, iCell Bioscience Inc, Shanghai) and human umbilical vein endothelial cells (HUVECs, iCell Bioscience Inc, Shanghai) were cultured in endothelial cell medium (ScienCell) supplemented with 5% fetal bovine serum, 1% growth factors, and 1% penicillin/streptomycin. Cells were treated with Control-Exos and TMAO-Exos at a concentration of 1: 100 (v/v) for 48 hours.

Western blot

The procedure was performed by standard protocols as previously described [13]. The exosomal protein concentration was determined using a BCA protein assay kit (23228, Thermo Scientific). Then the samples were separated by SDS-PAGE and transferred onto the Millipore polyvinylidene difluoride membranes. Primary antibody of CD81 was purchased from Servicebio, and the final antibody concentration was 1:1000. The expressions of CD81 were detected with enhanced chemiluminescence reagent (Millipore, USA).

Quantitative polymerase chain reaction

Quantitative polymerase chain reaction (qPCR) was performed by standard protocols as previously described [14]. Briefly, total RNA was extracted from treated HAECs using TRIzol reagent (Invitrogen, USA) and concentration was measured using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, USA). Then RNA was reverse transcribed into cDNA using the Color Reverse Transcription Kit (EZBioscience, USA). qPCR was performed on Bio-Rad CFX-96 (Bio-Rad, USA) with Color SYBR Green qPCR Master Mix (EZBioscience, USA). The mRNA expressions of interleukin-6 (IL-6), monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-α (TNF-α) and Caspase-3 were normalized to glyceraldehyde phosphate dehydrogenase (GAPDH) by using the 2^^-^△△^CT method. The qPCR primers used in the study were listed in Table 1.

Table 1 Quantitative polymerase chain reaction (qPCR) primers used in the study

Name	Species	Forward Sequence	Reverse Sequence
IL-6	Homo	TGGCAGAAAACAACCTGAACCTT	TCTGGCTTGTTCCTCACTACTCT
MCP-1	Homo	CTCATAGCAGCCACCTTCATTCC	GATCACAGCTTCTTTGGGACACT
TNF-α	Homo	CTCAGCCTCTTCTCCTTCCTGAT	TCGAGAAGATGATCTGACTGCCT
Caspase-3	Homo	CGGCGCTCTGGTTTTCGTTA	GTCCAGGGATATTCCAGAGTCCA
GAPDH	Homo	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG

IL-6, interleukin-6; MCP-1, monocyte chemotactic protein-1; TNF-α, tumor necrosis factor-α; GAPDH, glyceraldehyde phosphate dehydrogenase.

Cell apoptosis

Cells apoptosis was evaluated by using the Hoechst 33342 staining solution (Sigma). Briefly, the treated HAECs were washed twice with PBS and fixed with 4% paraformaldehyde for 10 minutes, and then washed twice with PBS again. Then Hoechst 33342 staining solution (10μg/mL) was added to cover cells, after incubating for 8 minutes in the dark, cells were washed twice with PBS. After that, cells were observed and imaged by a fluorescent microscope (Leica DMI4000B, Germany).

Exosomal miRNA expression profiling

Total RNA was isolated using TRIzol reagent (Invitrogen, USA), RNA concentration was measured using Qubit® RNA Assay Kit in Qubit® 2.0 Flurometer (Life Technologies, CA, USA) and RNA degradation and contamination was monitored on 1% agarose gels. After RNA quantification and qualification, 1 μg total RNA per sample was used as input material for the small RNA library. Sequencing libraries were generated using NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (NEB, USA.) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample and then library quality was assessed on the Agilent Bioanalyzer 2100 system using DNA High Sensitivity Chips. After cluster generation, the library preparations were sequenced on an Illumina NovaSeq 6000 platform and 50bp single-end reads were generated. After sequencing, clean data (clean reads) were obtained by removing reads containing ploy-N, with 5’ adapter contaminants, without 3’ adapter or the insert tag, containing ploy A or T or G or C and low-quality reads from raw data. At the same time, Q20, Q30, and GC-content of the raw data were calculated. Then, chose a certain range of length from clean reads to do all the downstream analyses. miRNA expression levels were estimated by TPM (transcript per million) and differential expression analysis between the control-Exos and TMAO-Exos samples (three biological replicates) was performed using the DESeq (v1.22.1).

Target genes prediction and functional enrichment analysis

Potential target genes were predicted from miRDB and miRBase databases. DAVID database was used for investigating the functional annotation of the target genes. GO analysis was performed to elaborate the biological functions and KEGG pathway enrichment was used to explore the relevant signal pathways, and networks were performed on Cytoscape platform (v3.8.2) [15]. STRING database (v11.0) [16] was used for analyzing the protein-protein interactions, and networks were performed on Cytoscape platform. P-value ≤ 0.05 was considered statistically significant.

Statistical Analysis

Data were presented as mean ± standard error of the mean (SEM). Statistical analysis was conducted using the SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). The comparisons between two groups were performed with independent t-test. P < 0.05 was considered statistically significant.

Isolation and characterization of exosomes from hepatocytes culture supernatant

Nanovesicles with diameters around 100 nm were isolated and purified from the cell culture supernatant, which were consistent with the characteristic size range of exosomes under electron microscopes (Fig. 1a). The size distribution of the exosomes showed no significant difference between Control-Exos and TMAO-Exos (Fig. 1b). The expression of exosomal identity marker CD81 was determined in Control-Exos and TMAO-Exos by western blotting, protein from 293T cells was set as negative control (Fig. 1c). Exosomes were labelled with DiI and co-cultured with HUVECs for 24 hours, and it was shown that DiI-labeled exosomes were internalized into HUVECs (Fig. 1d).

TMAO-Exos promoted inflammatory gene expression

Control-Exos and TMAO-Exos were added to HAECs and co-cultured for 48 hours. TMAO-Exos, but not control-Exos, significantly promoted the mRNA expressions of IL-6, MCP-1 and TNF-α (Fig. 2a, b, c). The results showed that TMAO-Exos could promote inflammatory activation in HAECs.

TMAO-Exos induced cell apoptosis

Control-Exos and TMAO-Exos were added to HAECs and co-cultured for 48 hours. TMAO-Exos, but not control-Exos, significantly induced cell apoptosis (Fig. 3a, b), and promoted the mRNA expression of Caspase-3 (Fig. 3c). The results showed that TMAO-Exos could lead to HAECs damage.

The expression profile of miRNAs in TMAO-Exos.

An RNA-sequencing strategy was conducted to identify the differentially expressed miRNAs between the Control-Exos and TMAO-Exos, and the miRNAs with a P-value ≤ 0.05 were visualized on a heatmap (Fig. 4). Compaired to the untreated group, a total of 17 miRNAs were changed significantly (｜log2(fold change)｜≥ 1 and P-value ≤ 0.05) after exposed to TMAO, in which eight miRNAs were considered as up-regulated, and nine of them were down-regulated (Table 2). Eight miRNAs labeled with a purely numerical code represented newly predicted genes, and it is worth noting that six of them are down-regulated, although the function is not yet known.

Table 2 The differentially expressed miRNAs between the Control-Exos and TMAO-Exos

	ID^*	Control-Exos_mean^#	TMAO-Exos_mean	Fold Change_Log2	P_value
Up	6_9856	53136.4	114742.9	1.110617915	4.24E-36
	7_11542	44.3	660.1	3.867285559	0.042018456
	miR-103-3p	1545.3	3120.6	1.013465437	0.017122205
	miR-302a-3p	0	467	8.87036472	0.035026562
	miR-302b-3p	0	3401.8	11.73250664	8.55E-12
	miR-302d-3p	0	766	9.583082768	0.003244933
	miR-744-5p	3541.9	7435.2	1.069634827	0.000621541
	miR-92a-3p	633.3	2048.6	1.692105134	0.001897612
Down	12_19875	3430.1	1407.5	-1.28451161	0.005508287
	15_23079	2314.9	479.1	-2.270166118	8.33E-05
	18_26561	492.8	54.4	-3.155968955	0.023602876
	2_2684	513.3	37.4	-3.743431938	0.014180519
	4_5543	443.1	17.1	-4.616822969	0.032070247
	9_14879	1712.3	456.2	-1.905880482	0.001012913
	miR-122-5p	2676.9	658.7	-2.021220078	0.000116753
	miR-199a-3p	672.1	0	-9.394677046	0.000582822
	miR-199b-3p	529	0	-9.049848549	0.003405104

Relative expression of exosomal miRNAs in Control-Exos and TMAO-Exos were determined using an RNA-sequencing strategy. A p-value threshold of 0.05 and｜log2(fold change)｜≥ 1 were used to select significantly differentially expressed miRNAs. ^*The miRNAs labeled with a purely numerical code represented newly predicted genes. ^#Counts per million (CPM) normalized counts were displayed and averaged from three biological duplicates. Control-Exos: exosomes isolated from TMAO-untreated group; TMAO-Exos: exosomes isolated from TMAO-treated group.

Prediction of miRNA‑mRNA network

As we known, miRNAs have vital function for negatively regulating protein expression through destabilizing or inhibiting translation of target mRNAs [17]. Therefore, we selected the known miRNAs from Table 2 for next analysis. Thirty-one candidates predicted to interact with the nine differentially expressed miRNAs were picked out and built a miRNAs-mRNA network using Cytoscape software to exhibit the complex interaction (Fig. 5).

GO and KEGG pathway enrichment analysis

GO analysis revealed that changes in the biological processes (BP) of the predicted target genes were significantly enriched in positive regulation of apoptotic signaling pathway, positive regulation of I-kappaB kinase/NF-kappaB signaling, and protein kinase B signaling, etc. The details were specified in Additional file 1. The interacting networks among these biological processes were constructed using ClueGO of Cytoscape (Fig. 6a). KEGG pathway analysis showed that the predicted target genes were strongly associated with the signal pathways that were pivotal in regulating inflammation and endothelial function, such as NF-κB signaling pathway, TNF signaling pathway and Apoptosis (Additional file 2), and the interactions among these signal pathways were constructed using ClueGO (Fig. 6b). The NF-κB signaling pathway (Fig. 7a) and Apoptosis signaling pathway (Fig. 7b) were exported from the KEGG database, the predicted target genes were highlighted in red for showing the positions in the signaling network.

Protein-protein interactions network analysis

To further explore the interactions among the predicted target genes, protein-protein interaction (PPI) networks analysis was processed using the STRING database. The comprehensive module with the highest score (0.998) included 24 nodes and 96 edges (Fig. 8a), which was further subdivided into two gene clusters by using MCODE of Cytoscape (Fig. 8b). Moreover, CytoHubba plug-in of Cytoscape identified Mcl1, Bcl2l11, Birc2, Mapk8, Mapk10, Aifm1, Akt1, Akt3, Casp9 and Map3k5 as the top 10 hub genes involved in this module, in which 10 nodes and 38 edges were included (Fig. 8c). Since other genes often interact with each other through these hub genes, it may be the key components of signaling pathways that control vascular inflammation and endothelial function.

In recent years, numerous studies have showed that intestinal flora and metabolites could exert regulatory effects on atherosclerosis by inhibiting or accelerating the disease process [18]. Study has confirmed that dietary choline and phosphatidylcholine could be metabolized into trimethylamine (TMA) in the intestinal microbiota, and then TMA would be absorbed into the liver, under catalysis of the flavin monooxygenase-3, TMA was further converted to TMAO [11]. Many clinical investigations have shown that high blood TMAO levels were an independent risk factor for atherosclerosis and serious cardiovascular events [11, 19, 20]. Furthermore, TMAO has been found to promote atherosclerosis via boosting inflammatory activation and impairing VECs function both in vitro and in vivo [3, 21, 22]. Results from LDLR^-/- mice demonstrated that increased blood TMAO levels could activate the NF-κB pathway and promote the expressions of inflammatory markers, thus leading to atherosclerosis formation [3]. And elevated plasma TMAO levels in rats could inhibit endothelial nitric oxide synthase (eNOS) expression and boost the production of inflammatory cytokine and superoxide, thus resulting in senescence-related endothelial dysfunction [21]. In vitro experiments showed that TMAO induced inflammation and endothelial dysfunction by inhibiting the activity of eNOS and provoked oxidative stress and activated inflammasome [22]. However, the effective concentrations of TMAO on VECs in vitro were much higher than the actual levels in body [3, 4, 19, 20, 22]. On the one hand, it may attribute to the complexity of the internal environment. But on the other hand, it may suggest that the molecular mechanism of TMAO on VECs remain incompletely understood, and the indirect factors contributing to inflammation and VECs injury might not be excluded. Since TMAO is produced in the live, hepatocytes may be the first potential target of TMAO. The results from recent related studies support the idea that there existed some relationships between TMAO and liver. Sifan Chen and colleagues recently found that TMAO at a physiological concentration could directly bind to hepatic endoplasmic reticulum stress kinase PERK and activated the unfolded protein response, and thus promoting metabolic dysfunction [12]. Another study in animal models of atherosclerosis has found that hepatic miR-146a-5p expression was associated with blood TMAO [23].

Recent studies have shown that exosomes, including hepatocyte-derived exosomes, were involved in atherosclerosis via regulating inflammation and vascular endothelial function [9, 24]. In addition, Hirsova P and colleagues have found that primary hepatocytes and Huh7 cells stimulated with lipid released more extracellular vesicles (which possessed the characteristic of exosomes), thereby enhancing the expressions of IL-1β and IL-6 in macrophages via the tumor necrosis factor-related apoptosis-inducing ligand contained in these vesicles [10]. In the present study, we provided evidence that TMAO at a physiological concentration could directly stimulate normal hepatocytes to release exosomes, which were able to promote the expressions of IL-6, MCP-1 and TNF-α, and induced VECs apoptosis. As is well-known, IL-6, MCP-1 and TNF-α are the key inflammatory factors and play pivotal roles in regulation of inflammation, endothelial dysfunction, and atherosclerosis. IL-6 has been confirmed to exert central roles in the pathogenesis of atherosclerosis [25]. In hypertensive patients combined with coronary artery disease, blood MCP-1 levels were elevated and related to the degree of endothelial damage [26], and MCP-1 secretion from VECs was involved in atherosclerosis [27]. And the role of TNF-α in inducing endothelial dysfunction has been established [28]. VECs apoptosis reflects the damage of endothelial barrier and represents the initial event of atherogenesis [29]. Now widely accepted that VECs injury plays a key role in the development of atherosclerosis [30]. Our previous study has found that proinflammatory lipid could impair eNOS activity and induce VECs apoptosis [13].

It has been recognized that miRNAs carried by exosomes could be actively absorbed by both neighboring and distal cells to exert regulatory roles in the pathogenesis of cardiovascular diseases, and the specific functions depend on the host-cell molecular architecture. Besides, the differential expression of exosomal miRNAs have been found to be promising biomarkers for early detection of cardiovascular diseases [31]. The latest research showed that steatotic hepatocyte-derived exosomes could transfer miR-1 to VECs, thus inhibiting KLF4 expression and activating NF-κB pathway, thus facilitating endothelial inflammation and atherogenesis [9]. Zheng B and colleagues also found that exosomes secreted from vascular smooth muscle cells (VSMCs) mediated the communication between VSMCs and VECs by transferring KLF5-induced miR-155 to VECs, ultimately impaired endothelial function and accelerated atherogenesis progression [32]. In our study, miRNAs carried by the TMAO-treated hepatocyte-derived exosomes were quite different from that in the untreated group, including several well-known miRNAs, such as miR-92a-3p, miR-103-3p, miR-122-5p and miR-199a-3p, etc. Further bioinformatics analysis showed that these differentially expressed miRNAs were predicted to target mRNAs such as Mapk8, Casp9, Mapk10, Bcl2l11, Ikbkg and Akt1, which were supposed to be involved in the signal pathways related to inflammation and vascular endothelial function, including cell apoptosis. A large body of evidence has demonstrated that NF-κB signaling pathway, TNF signaling pathway, Apoptosis signaling pathway, Toll-like receptor signaling pathway and FoxO signaling pathway play a crucial role in inflammation, endothelial function, and atherosclerosis [28, 29, 33-36]. Particularly, NF-κB signaling pathway has been at the crossroads of inflammation and atherogenesis [33], and specific NF-κB inhibition of endothelial cell reduced proinflammatory gene expression such as IL-6 and TNF, and protected ApoE^-/-mice from atherosclerosis [34]. Recent studies have revealed that exosome derived from CD137-modified endothelial cells could promote Th17 cell differentiation and atherosclerosis progression in ApoE^-/- mice through NF-κB pathway mediated IL-6 expression [37], and exosomes released from mature dendritic cells carried TNF-a on exosome membrane, which was found to be efficient in activating the NF-κB pathway, thus provoking endothelial inflammation and atherosclerosis [24]. Furthermore, there exists a close relationship between the NF-κB pathway and the inflammatory cytokines of IL-6, MCP-1 and TNF-α. IL-6 and MCP-1 contain the binding elements for NF-κB, which is critical for transcriptional induction of IL-6 and MCP-1 genes, and TNF-a serves as one of the NF-kB-activating factors, inducing IL-6 and MCP-1 transcription intensely [38, 39].

So far, to our best knowledge, no studies have defined the relationship between hepatocyte-derived exosomes and the facilitating effects of TMAO on vascular inflammation and endothelial dysfunction. The intriguing findings demonstrated that hepatocyte-derived exosomes undertook the proatherogenic roles of TMAO in the vasculature, at least in part, via transferring a cluster of miRNAs to the endothelial cells. And further analysis indicated that the level and diversity of the exosomal miRNAs could be directly correlated with the TMAO-induced vascular inflammation and endothelial dysfunction. Future investigation of the precise mechanisms whereby circulating exosomal miRNAs interact with the corresponding target genes to irritate inflammatory response and impair endothelial function will increase our knowledge of the roles of TMAO in vascular health and atherosclerosis.

In the present study, we found that TMAO was able to stimulate normal hepatocytes to produce exosomes, which could be absorbed by endothelial cells, thus enhancing the mRNA expressions of inflammatory cytokines and cell apoptosis via transferring a cluster of miRNAs to the VECs and regulated signal pathways related to inflammation and vascular endothelial function. These studies may provide a new insight into the interactions between liver and vascular endothelial in the atherogenic process orchestrated by TMAO, at least in part, could be attributable to the hepatocyte-derived exosomes and the loaded miRNAs, which suggests that targeting this cellular crosstalk may provide a novel approach that can restrain the deleterious effects induced by TMAO on VECs.

TMAO: trimethylamine-N-oxide; miRNAs: microRNAs; VECs: vascular endothelial cells; AML12: alpha mouse liver 12; DMEM/F12: Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12; Control-Exos: exosomes isolated from TMAO-untreated group; TMAO-Exos: exosomes isolated from TMAO-treated group; PBS: Phosphate-buffered saline; HAECs: human aortic endothelial cells; HUVECs: human umbilical vein endothelial cells; BCA: bicinchoninic acid; SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis; qPCR: quantitative polymerase chain reaction; cDNA: complementary DNA; IL-6: interleukin-6; MCP-1: monocyte chemotactic protein-1; TNF-α: tumor necrosis factor-α; GAPDH: glyceraldehyde phosphate dehydrogenase; DAVID: the database for annotation, visualization and integrated discovery; GO: Gene ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes; SEM: standard error of the mean; 293T: human embryonic kidney 293T; BP: biological processes; NF-κB: nuclear factor-κB; PPI: protein-protein interaction; Mcl1: MCL1 apoptosis regulator, BCL2 family member; Bcl2l11: BCL2 apoptosis regulator like 11; Birc2: baculoviral IAP repeat containing 2; Mapk8: mitogen-activated protein kinase 8; Mapk10: mitogen-activated protein kinase 10; Aifm1: apoptosis inducing factor mitochondria associated 1; Akt1: AKT serine/threonine kinase 1; Akt3: AKT serine/threonine kinase 3; Casp9: caspase 9; Map3k5: mitogen-activated protein kinase kinase kinase 5; TMA: trimethylamine; LDLR: low density lipoprotein receptor; eNOS: endothelial nitric oxide synthase; PERK: eukaryotic translation initiation factor 2 alpha kinase 3; IL-1β: interleukin-1β; KLF4: Kruppel like factor 4; VSMCs: vascular smooth muscle cells; KLF5: Kruppel like factor 5; Ikbkg: inhibitor of nuclear factor kappa B kinase regulatory subunit gamma; FoxO: forkhead box, sub-group O; ApoE: apolipoprotein E.

Ethics approval and consent to participate

Not applicable.

Consent for Publication

Not applicable.

Availability of data and materials

All data generated or analysed during this study are included in this published article and its supplementary information files.

Competing interests

The authors declare that they have no competing interests.

Funding

The study was supported by the National Key Research and Development Program of China (No. 2018YFC1002600, No. 2020YFC2008005); Guangdong peak project (No. DFJH201802, No. DFJH2019); Science and Technology Planning Project of Guangdong Province, China (No. 2019B020230003); Science and Technology Planning Project of Guangzhou (No.202002020030).

Authors’ contributions

XL, YJS, JT and JMC conceived and designed the study as well as analyzed and interpreted the data; JT and JMC directed the research and revised the manuscript; XL and YJS drafted the manuscript; XL, YJS, JZCT and JPS performed the experiments. ZCW and LFL helped with analysis and interpretation of some data. All authors read and approved the final manuscript.

Acknowledgments

Not applicable.

Author details

¹Department of Cardiovascular Surgery, Guangdong Cardiovascular Institute, Guangdong Provincial Key Laboratory of South China Structural Heart Disease, Guangdong Provincial People’s Hospital, Guangdong Academy of Medical Sciences, Zhongshan 2nd Road 106, Guangzhou 510080, China.

²Department of Hypertension and Vascular Diseases, The First Affiliated Hospital, Sun Yat-sen University; NHC Key Laboratory of Assisted Circulation (Sun Yat-sen University), Zhongshan 2nd Road 58, Guangzhou 510080, China.

³School of Medicine, South China University of Technology, Guangzhou Higher Education Mega Center, Panyu District, Guangzhou 510006, Guangdong Province, China.

⁴Department of Geriatrics, Peking University Shenzhen Hospital, No.1120, Lianhua Road, Shenzhen 518035, China.

Roth GA, Mensah GA, Johnson CO, Addolorato G, Ammirati E, Baddour LM, Barengo NC, Beaton AZ, Benjamin EJ, Benziger CP, et al: Global Burden of Cardiovascular Diseases and Risk Factors, 1990-2019: Update From the GBD 2019 Study.J Am Coll Cardiol 2020, 76:2982-3021.
Spann NJ, Garmire LX, McDonald JG, Myers DS, Milne SB, Shibata N, Reichart D, Fox JN, Shaked I, Heudobler D, et al: Regulated Accumulation of Desmosterol Integrates Macrophage Lipid Metabolism and Inflammatory Responses.Cell 2012, 151:138-152.
Seldin MM, Meng Y, Qi H, Zhu W, Wang Z, Hazen SL, Lusis AJ, Shih DM: Trimethylamine N-Oxide Promotes Vascular Inflammation Through Signaling of Mitogen-Activated Protein Kinase and Nuclear Factor-kappaB.J Am Heart Assoc 2016, 5.
Singh GB, Zhang Y, Boini KM, Koka S: High Mobility Group Box 1 Mediates TMAO-Induced Endothelial Dysfunction.Int J Mol Sci 2019, 20:3570.
Liu Y, Dai M: Trimethylamine N-Oxide Generated by the Gut Microbiota Is Associated with Vascular Inflammation: New Insights into Atherosclerosis.Mediators Inflamm 2020, 2020:4634172.
Thery C, Zitvogel L, Amigorena S: Exosomes: composition, biogenesis and function.Nat Rev Immunol 2002, 2:569-579.
Vidal M: Exosomes: Revisiting their role as "garbage bags".Traffic 2019, 20:815-828.
Kourembanas S: Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy.Annu Rev Physiol 2015, 77:13-27.
Jiang F, Chen Q, Wang W, Ling Y, Yan Y, Xia P: Hepatocyte-derived extracellular vesicles promote endothelial inflammation and atherogenesis via microRNA-1.J Hepatol 2020, 72:156-166.
Hirsova P, Ibrahim SH, Krishnan A, Verma VK, Bronk SF, Werneburg NW, Charlton MR, Shah VH, Malhi H, Gores GJ: Lipid-Induced Signaling Causes Release of Inflammatory Extracellular Vesicles From Hepatocytes.Gastroenterology 2016, 150:956-967.
Wang Z, Klipfell E, Bennett BJ, Koeth R, Levison BS, DuGar B, Feldstein AE, Britt EB, Fu X, Chung Y, et al: Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease.Nature 2011, 472:57-63.
Chen S, Henderson A, Petriello MC, Romano KA, Gearing M, Miao J, Schell M, Sandoval-Espinola WJ, Tao J, Sha B, et al: Trimethylamine N-Oxide Binds and Activates PERK to Promote Metabolic Dysfunction.Cell Metab 2019, 30:1141-1151.
Ou ZJ, Chen J, Dai WP, Liu X, Yang YK, Li Y, Lin ZB, Wang TT, Wu YY, Su DH, et al: 25-Hydroxycholesterol impairs endothelial function and vasodilation by uncoupling and inhibiting endothelial nitric oxide synthase.Am J Physiol Endocrinol Metab 2016, 311:E781-E790.
Zhou L, Liu X, Wang ZQ, Li Y, Shi MM, Xu Z, Ou ZJ, Li HM, Cheng TP, Jian YP, et al: Simvastatin Treatment Protects Myocardium in Noncoronary Artery Cardiac Surgery by Inhibiting Apoptosis Through miR-15a-5p Targeting.J Cardiovasc Pharmacol 2018, 72:176-185.
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T: Cytoscape: a software environment for integrated models of biomolecular interaction networks.Genome Res 2003, 13:2498-2504.
Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, Simonovic M, Doncheva NT, Morris JH, Bork P, et al: STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets.Nucleic Acids Res 2019, 47:D607-D613.
Carrington JC, Ambros V: Role of microRNAs in plant and animal development.Science 2003, 301:336-338.
Chistiakov DA, Bobryshev YV, Kozarov E, Sobenin IA, Orekhov AN: Role of gut microbiota in the modulation of atherosclerosis-associated immune response.Front Microbiol 2015, 6:671.
Tang WH, Wang Z, Levison BS, Koeth RA, Britt EB, Fu X, Wu Y, Hazen SL: Intestinal microbial metabolism of phosphatidylcholine and cardiovascular risk.N Engl J Med 2013, 368:1575-1584.
Koeth RA, Wang Z, Levison BS, Buffa JA, Org E, Sheehy BT, Britt EB, Fu X, Wu Y, Li L, et al: Intestinal microbiota metabolism of L-carnitine, a nutrient in red meat, promotes atherosclerosis.Nat Med 2013, 19:576-585.
Li T, Chen Y, Gua C, Li X: Elevated Circulating Trimethylamine N-Oxide Levels Contribute to Endothelial Dysfunction in Aged Rats through Vascular Inflammation and Oxidative Stress.Front Physiol 2017, 8:350.
Sun X, Jiao X, Ma Y, Liu Y, Zhang L, He Y, Chen Y: Trimethylamine N-oxide induces inflammation and endothelial dysfunction in human umbilical vein endothelial cells via activating ROS-TXNIP-NLRP3 inflammasome.Biochem Biophys Res Commun 2016, 481:63-70.
Coffey AR, Kanke M, Smallwood TL, Albright J, Pitman W, Gharaibeh RZ, Hua K, Gertz E, Biddinger SB, Temel RE, et al: microRNA-146a-5p association with the cardiometabolic disease risk factor TMAO.Physiol Genomics 2019, 51:59-71.
Gao W, Liu H, Yuan J, Wu C, Huang D, Ma Y, Zhu J, Ma L, Guo J, Shi H, et al: Exosomes derived from mature dendritic cells increase endothelial inflammation and atherosclerosis via membrane TNF-alpha mediated NF-kappaB pathway.J Cell Mol Med 2016, 20:2318-2327.
Eltoft A, Arntzen KA, Wilsgaard T, Mathiesen EB, Johnsen SH: Interleukin-6 is an independent predictor of progressive atherosclerosis in the carotid artery: The Tromso Study.Atherosclerosis 2018, 271:1-8.
Tucci M, Quatraro C, Frassanito MA, Silvestris F: Deregulated expression of monocyte chemoattractant protein-1 (MCP-1) in arterial hypertension: role in endothelial inflammation and atheromasia.J Hypertens 2006, 24:1307-1318.
Dje NP, Riediger F, Vardarova K, Scharf S, Eitel J, Opitz B, Slevogt H, Weichert W, Hocke AC, Schmeck B, et al: Statins control oxidized LDL-mediated histone modifications and gene expression in cultured human endothelial cells.Arterioscler Thromb Vasc Biol 2009, 29:380-386.
Deng X, Chu X, Wang P, Ma X, Wei C, Sun C, Yang J, Li Y: MicroRNA-29a-3p Reduces TNFalpha-Induced Endothelial Dysfunction by Targeting Tumor Necrosis Factor Receptor 1.Mol Ther Nucleic Acids 2019, 18:903-915.
Heo KS, Lee H, Nigro P, Thomas T, Le NT, Chang E, McClain C, Reinhart-King CA, King MR, Berk BC, et al: PKCzeta mediates disturbed flow-induced endothelial apoptosis via p53 SUMOylation.J Cell Biol 2011, 193:867-884.
Gimbrone MJ, Garcia-Cardena G: Endothelial Cell Dysfunction and the Pathobiology of Atherosclerosis.Circ Res 2016, 118:620-636.
Aghabozorgi AS, Ahangari N, Eftekhaari TE, Torbati PN, Bahiraee A, Ebrahimi R, Pasdar A: Circulating exosomal miRNAs in cardiovascular disease pathogenesis: New emerging hopes.J Cell Physiol 2019, 234:21796-21809.
Zheng B, Yin WN, Suzuki T, Zhang XH, Zhang Y, Song LL, Jin LS, Zhan H, Zhang H, Li JS, Wen JK: Exosome-Mediated miR-155 Transfer from Smooth Muscle Cells to Endothelial Cells Induces Endothelial Injury and Promotes Atherosclerosis.Mol Ther 2017, 25:1279-1294.
Pateras I, Giaginis C, Tsigris C, Patsouris E, Theocharis S: NF-κB signaling at the crossroads of inflammation and atherogenesis: searching for new therapeutic links.Expert Opin Ther Tar 2014, 18:1089-1101.
Gareus R, Kotsaki E, Xanthoulea S, van der Made I, Gijbels MJ, Kardakaris R, Polykratis A, Kollias G, de Winther MP, Pasparakis M: Endothelial cell-specific NF-kappaB inhibition protects mice from atherosclerosis.Cell Metab 2008, 8:372-383.
Polykratis A, van Loo G, Xanthoulea S, Hellmich M, Pasparakis M: Conditional targeting of tumor necrosis factor receptor-associated factor 6 reveals opposing functions of Toll-like receptor signaling in endothelial and myeloid cells in a mouse model of atherosclerosis.Circulation 2012, 126:1739-1751.
Menghini R, Casagrande V, Iuliani G, Rizza S, Mavilio M, Cardellini M, Federici M: Metabolic aspects of cardiovascular diseases: Is FoxO1 a player or a target?Int J Biochem Cell Biol 2020, 118:105659.
Xu L, Geng T, Zang G, Bo L, Liang Y, Zhou H, Yan J: Exosome derived from CD137-modified endothelial cells regulates the Th17 responses in atherosclerosis.J Cell Mol Med 2020, 24:4659-4667.
Murakami M, Kamimura D, Hirano T: Pleiotropy and Specificity: Insights from the Interleukin 6 Family of Cytokines.Immunity 2019, 50:812-831.
Ping D, Boekhoudt G, Zhang F, Morris A, Philipsen S, Warren ST, Boss JM: Sp1 binding is critical for promoter assembly and activation of the MCP-1 gene by tumor necrosis factor.J Biol Chem 2000, 275:1708-1714.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Hepatocyte-Derived Exosomal microRNAs Orchestrate Vascular Inflammation and Endothelial Function: Insights Into Molecular Mechanisms of Trimethylamine-N-Oxide in Atherosclerosis

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1