Rhizobial strains
Chickpea strain CC1192 and field isolates identified as 3/4, 6/7, and F21 were sourced from the rhizobia collection held at the university of Sydney. From field trials conducted in Narrabri, (NSW) and Kununurra (WA) in 2018 (prefix N = Narrabri, K = Kununurra), fifteen additional nodule isolates identified as K8, K66, K72, K185, K188, K203, K208, K218, K230, K264, N5, N90, N128, N159 and N300 were extracted from nodules on Kyabra and Kimberley Large plants after 9 weeks of growth. To obtain these isolates, a total of nine plants were dug from each of 80 treatment plots across three random positions in the plots in both Narrabri and Kununurra. Approximately 20 nodules were picked from the harvested plant roots from each plot. Nodules were surface sterilized with 95% ethanol for 1 min and treated with 5% NaClO for 6 min before rinsing 6 times with sterile deionised water. Surface sterilized nodules were placed in sterile Petri plates and individually macerated using a sterile glass rod. The nodule content on the tip of the glass rod was then aseptically streaked across the surface of congo-red yeast mannitol agar (CRYMA) in Petri plates (Vincent 1970). In total, 3200 streaked plates were incubated at 28 oC for 3–7 days after which time single colonies showing presumptive rhizobial growth were sub-cultured onto fresh CRYMA medium. After further incubation, each isolate was visually assessed for typical growth characteristics, purity, colour and microscopic examination including Gram stain. Pure cultures of each isolate were stored on YMA (Vincent 1970) slopes in McCartney bottles.
RAPD PCR fingerprinting and symbiotic authentication of rhizobia
Rhizobia genomic DNA extraction
For each isolate, a broth culture was prepared aseptically in a flask by inoculating sterile yeast mannitol medium (YM) (Vincent 1970) with a loopful of pure bacterial culture from an agar slope and incubated at 28 oC for 72 h. DNA of each isolate from the broth culture was extracted using Bioline meridian ISOLATE II Genomic DNA Kit (Lot No. IS503-B078370) according to the manufacturers instruction (Bioline 2020) and the concentration and purity were estimated (Thermo Scientific NANODROP LITE Spectrophotometer, SN:1442) at 260–280 nm.
RAPD PCR RPO1 fingerprinting for bacterial grouping
25 µl mastermix consisting of 19 µl Nuclease free water, 5.5 µl MyTaq Red Buffer, 0.25 µl RPO1 primer (5’AATTTTCAAGCGTCGTGCCA3’) and 0.22 µl MyTaq DNA polymerase was prepared in 1.5 ml sterile Eppendorf tubes for each amplification reaction and vortexed (Teaumroong and Boonkerd 1998). 22.5 µL of the master mix was pipetted into 0.2 ml PCR tube under sterile conditions and 2.5 µl of the experimental DNA was added. The process was repeated for all DNA samples of the isolates that were deemed putative rhizobia, and the inoculant strains 3/4, 6/7, F21, CC1192 and a negative sterile water control was also included. The samples were amplified by a sequence of PCR cycling times and temperatures consisting of 5 cycles of 30 s denaturation at 92 oC, 2 min annealing at 40 oC and 90 s extension at 72 oC, then 35 cycles of 5 s at 92 oC, 25 s at 45 oC and 90 s at 72 oC, followed by a final cycle of 10 s at 92 oC, 20 s at 45 oC and 5 min at 72°C. The PCR product size was confirmed by electrophoresis on a 2% (w/v) TAE agarose gel.
Authentication of rhizobia
Seeds of Desi chickpea (Kyabra) were surface-sterilized (Vincent 1970) and pre-germinated in a sterile glass conical flask. In a glasshouse, sufficient plant growth assemblies were prepared by placing one sterile 30 mm diameter peat pellet (Jiffy Products (NB) Ltd, Canada, BATCH # 10328049) in a clear plastic 700 ml cup covered with a clear dome lid. Each growth assembly was irrigated with sterilized nitrate-free Jensen’s modified plant growth nutrient solution (1.0 g CaHPO4, 0.2 g K2HPO4, 0.2 g MgSO4.7H2O, 0.2 g NaCl and 0.1 g FeCl3 major elements/L deionized water and 10 ml/L trace elements consisting of a mixture of 2.86 g H3BO3, 2.03 g MnSO4.4H2O, 0.22 g ZnSO4, 0.08 g CuSO4.5H2O, 0.14 g Na2MoO4.2H2O/L deionized water) (Jensen 1962). The solution was pH adjusted to 6.8 using 1 M NaOH solution.
Sprouted seedlings were sown singly into each cup and the cups placed in a glasshouse set at 26/18°C day/night temperatures, 60% relative humidity and a light intensity at pot level of 600 µmol/m2 s− 1 across a 14/10 day/night light period. After sowing, plants were watered at fortnightly intervals.
Pure broth cultures were prepared of the field-tested inoculant strains v.z., CC1192, 3/4, 6/7 and F21 and the fifteen nodule isolates viz., K8, K66, K72, K185, K188, K203, K208, K218, K230, K264, N5, N90, N128, N159 and N300 that showed different RPO1 fingerprint patterns from strain CC1192, 3/4, 6/7 and F21 were each used to inoculate 10 replicate Kyabra plants. For each strain and isolate, a loopful of pure bacterial culture was transferred into 1 ml sterile RO water to form a turbid suspension and then 200 µl of the suspension was used to inoculate one pre-germinated seed. The experiment also included 10 uninoculated replicate plants as a control. The inoculated seedlings in growth assemblies were evenly spaced in a randomized layout within the glasshouse.
After 6 weeks growth from inoculation day, nodules were counted and dry weight of shoots for each treatment were recorded after oven drying at 60 oC for 72 hours.
Amplification and sequencing of 16S rRNA and rpoB genes for phylogenetic analysis of strains
Based on nodulation response and biomass accumulation in the glasshouse experiment, 8 of the 15 field isolates viz., N5, N300, K66 and K188, K8, K72, K203 and K208 and two of the test inoculants strains viz., 3/4 and 6/7 were subjected to phylogenetic analysis to test for differentiation in strains. For each reaction to amplify a gene sample (Gunnabo et al. 2021), a total reaction volume of 20µl was prepared from 4 µl 5x Phusion HF, 0.4 µl 10 mM dNTPs, 1 µl each of forward and reverse primers (Table 1), 0.6 µl DMSO, 0.2 µl Phusion DNA Polymerase, 11.8 µl Nuclease free water and 1µl template DNA. The DNA amplification process (Applied Biosystems Veriti 96-Well Thermal Cycler Model 9901) included CC1192 positive rhizobia and sterile water negative controls. PCR cycling process for each primer set was as illustrated in Table 1. The product size of PCR was confirmed by electrophoresis (Bio-Rad Wide Mini Sub-Cell GT Agarose Gel Electrophoresis System) on a 1% agarose gel (Bio-Rad International-Lot No. ES520-BO17430) and DNA was extracted from the agarose gel using Bioline meridian ISOLATE II PCR & Gel Kit (Lot No:IS496-B080610) according to the manufacturer’s instruction. DNA was sequenced by Australian Research and Genomic Facility (ARGF) in Sydney, Australia
Table 1
PCR Cycling process and primer set
Gene | Primer | Annealing temperature | Primer reference |
16S rRNA | 27F (AGAGTTTGATCMTGGCTCAG) 1492R (CGGTTACCTTGTTACGACTT) | 59.0 oC | (Hou et al. 2018) |
rpoB | rpoB-83F (CCTSATCGAGGTTCACAGAAGGC) rpoB1061R (AGCGTGTTGCGGATATAGGCG) | 62.0 oC | (Aserse et al. 2012) |
All annealing temperatures were set for 20 sec and other PCR cycling conditions were 30 sec at 98 oC for Initial Denaturation, 33 x (10 sec at 98 oC) for Denaturation, 1 min at 72 oC for Extension, 10 min at 72 oC for Final Extension and 4oC for Hold |
Preparation of inoculants
Peat inoculants were prepared for CC1192 and six of the phylogenetically analyzed strains viz., 3/4, 6/7, N5, N300, K66 and K188. These were selected for their unique nodulation and heat tolerant characteristic.
For each strain, a culture was grown in yeast mannitol broth (YMB, 1.0g Bacto yeast extract powder, 0.2g MgSO4.7H2O, 0.5g K2HPO4, 10.0g mannitol and 0.1g NaCl/L of distilled water) and incubated at 28°C until the broth culture contained in the order of log109 cells per ml. Inoculants were prepared by aseptically injecting 100 ml broth culture of each strain singly into 250g packets of sterile finely milled commercial grade peat, sealed and incubated at 28oC for 14 days.
Field experiment
A chickpea field trial was established at the Department of Primary Industries and Regional Development's (DPIRD) Frank Wise Institute of Tropical Agriculture, Kununurra, WA in Autumn 2019. The area for irrigation was 0.792 ha and reportedly had no history of inoculated chickpeas for at least four years prior to the establishment of this trial. Soil type was the Cununurra clay with pH ranging from 7.5-8. Annual average rainfall and maximum/minimum temperatures of the site were 832.7 mm and 35.1/21.2 oC respectively (Kununurra research facility weather station data) and available soil N was ~ 30 kg N/ha.
Peat slurries were prepared for each of 7 strains viz., 3/4, 6/7, N5, N300, K66, K188 and CC1192 at a rate of 250g peat/500 ml sterile water to treat 100 kg chickpea seeds. Kyabra and Kimberley Large seeds were then slurry-inoculated at the recommended rate and sown into irrigated raised beds of length 11 m and size 19.8 m2. 60 kg N/ha (i.e., +N) and -rhizobia/-N controls were included to make a total of 9 treatments. There were 4 replicate plots per treatment and seeding rates for, Kimberley Large and Kyabra were 112.7 and 44.41 kg/ha respectively. Estimated germination rate and plants/m2 were 85% and 15 m2 respectively. Each strain was confounded to one row and there was one buffer row between treatment plots. The treatments were arranged in a randomized complete block design.
Data collection was at week 6, 9 and final grains harvest. At 6 weeks after sowing, a total of nine plants were dug from each treatment plot across three random positions within the plot to visually assess nodulation. Nodule dry weight for treatments after week 9 were measured after drying for 72 h at 60 oC. Dry shoot and seed samples were ground into fine constituents (SPEX Sample Prep 2010, Geno/Grinder) and weighed ~ 30–40 mg (Sartorius) into ultra-light weight 37 x 37 mm tin foil square and encapsuled to 9 mm pellet diameter (Manual press 9 mm pellet diameter 41.01-0004) and analysed for % N on CHNS analyzer vario MACRO cube (Elementar Analysensysteme GmbH, Langenselbold, Germany) using equation below (Unkovich et al. 2008).
$$Plant N=\frac{DSW x \text{%}N}{100} x 1000$$
Relative symbiotic effectiveness (RSE%) of the test strains was calculated by comparing shoot dry weight of each test strain treatment with that of CC1192 positive control (Denton et al. 2000; Elias and Herridge 2015; Zaw et al. 2021) using the equation, \(RSE\%=\frac{X}{y}\times 100\). Where x is shoot dry weight of plants inoculated with test strains and y is shoot dry weight of CC1192 inoculated plants. RSE% of strains greater than 80%, ranging from 60–80% and less than 60% were rated as effective, poorly effective and ineffective respectively.
Estimation of most probable number and nodule occupancy of rhizobia strains
The most probable number (MPN) of viable inoculant rhizobia in root rhizospheres were estimated using rhizosheath soil washed from the roots of sampled plants (Cochran 1995). Roots collected from the field experiment were washed in 100ml sterile water to form a suspension. 100µl of 10− 0, 10− 1, 10− 2, 10− 3 and 10− 4 dilution of a 10-fold serial dilution of 100µl of the suspension from each plot were each used to inoculate triplicate plants established in Gemell growth assembly (Hartley et al. 2008). Inoculated seeds were placed on a capsized test tube, wrapped in a non-bleached paper towel and then placed in ~ 400 ml sterile nitrate-free Jensen’s modified plant growth nutrient solution in clear plastic cups and covered with dome lids and grown under similar conditions as in the rhizobia authentication experiment above. +N and uninoculated controls were included as measures of fixation efficiency. Soils from Kimberley Large plots were used to inoculate Kimberley Large seeds while those from Kyabra were used to inoculated Kyabra seeds. Nodulation assessment was at 6 weeks after sowing. The MPN of viable rhizobia in the rhizosphere soil for each treatment was determined using a probability table (Gemell 1991).
In addition, nodule contents of 1600 nodules sampled from Kununurra at week 9 were isolated and analysed genetically (Amplified Polymorphic DNA Polymerase Chain Reaction) to determine nodule occupancy abilities of the inoculant strains (Gauri et al. 2011). Based on the fingerprint patterns, the isolates were identified as either an inoculant strain or background population. The fingerprints of week 9 sampled nodule isolates were compared to the fingerprints of their source plot inoculant strains (i.e., 3/4, 6/7, N5, N300, K66, K188 and CC1192) to estimate the ratio of nodule occupancy of inoculant strains versus resident population.
Statistical analysis
All statistical analysis were done using GraphPad Prism version 9.1.2 for Windows (GraphPad Software, San Diego, California, USA) and Microsoft excel. Analysis of variance (ANOVA) was used to test for the interactive and non-interactive effects of all treatments in the glasshouse and field experiments. Mean comparisons of grain yield and 100 seed weight were performed when analysis of variance (AOV) Treatment P(F) was significant and where there were missing data, the effective replicates used for mean comparisons were adjusted.