microRNA target prediction
TargetScan online database (http://www.targetscan.org/index.html) were used to identify potential miRNA targets.
Mice experiment
The mice experiments in this study were approved by the Animal Research Committee of Doshisha Women’s College of Liberal Arts (Approval ID: Y19-025).
The saline or bleomycin were injected subcutaneously into the back of the mice (male 8 weeks old C57BL/6J mice) as previously described (19). The saline or bleomycin was injected subcutaneously daily for up to 2 weeks. The miRNA negative control or miR-30c (sequence: UGUAAACAUCCUACACUCUCAGC Bioneer, CA, USA)(10 mg/body) was injected subcutaneously every a week for up to 2 weeks, using JetPEI transfection reagent (Polyplus transfection, Illkirch, France) according to the manufacturer’s instructions.
Western blot analysis
We performed a Western blot analysis as previously described (28). The skin samples from mice were homogenized and sonicated in the lysis buffer containing 10 mM Tris-HCl buffer (pH 7.5), 1% SDS, 1% Triton X-100. The protein concentration in each lysate was measured using a BCA protein assay kit (Pierce, IL, USA). Proteins were separated by electrophoresis on 10% SDS-polyacrylamide gels and transferred to a PVDF membrane. We detected α2AP, type I collagen and GAPDH by incubation with anti-α2AP antibodies (Santa Cruz Biotechnology, CA, USA), anti-type I collagen antibodies (Bioss antibodies, MA, USA), anti-α-SMA antibody (Genetex, CA, USA), anti-VE-cadherin antibody (Santa Cruz Biotechnology, CA, USA) and anti-GAPDH antibodies (Sigma-Aldrich, MO, USA) followed by incubation with horseradish peroxidase-conjugated antibodies to rabbit IgG (Amersham Pharmacia Biotech, Uppsala, Sweden).
Measurement of dermal thickness
The dermal thickness (distance from the epidermal-dermal junction to dermal-subcutaneous junction) was determined by calculating the average of three-point measurement in each skin section. The measurements were carried out in a blinded fashion. The dermal thickness was measured in the skin sections from each group of mice (n = 3).
Collagen content in skin and lung (The sircol biochemical assay)
The collagen content was assessed using sirius red staining as previously described (29). The stained images obtained from separate fields on the specimens were analyzed by using ImageJ. The collagen content was determined as the percent ratio of the sirius red-positive area in saline plus control miRNA-injected mice.
Immunohistochemical staining of α-SMA and VE-cadherin
The immunohistochemical staining was performed as previously described (30). Paraffin sections were labeled with anti-α-SMA antibody (GeneTex, CA, USA) or anti-VE-cadherin (Santa Cruz Biotechnology, CA, USA), then secondarily labeled with Cy3-conjugated anti-rabbit IgG (Thermo Scientific, CA, USA). The signals were then detected using a laser-scanning microscope.
Blood flow in the skin
Blood flow in the skin was measured for 10 seconds using a laser Doppler flow meter (BRL-100; Bio Research Center, Tokyo, Japan), and determined by calculating the average of three-time measurements in each skin.
Assessment of lung fibrosis score
The lung fibrosis score was assessed as described by Ashcroft et al (31). The lung fibrosis was graded on a scale of 0–8 by examining randomly chosen fields. The criteria for grading lung fibrosis was as follows: 0; normal lung, grade 1; minimal fibrous thickening of alveolar or bronchiolar walls, grade 3; moderate thickening of walls without obvious damage to lung architecture, grade 5; increased fibrosis with definite damage to lung structure and formation of fibrous bands or small fibrous masses, grade 7; severe distortion of structure and large fibrous area, 8; total fibrous obliteration of the field. Grade 2, 4, and 6 were used as intermediate pictures between the aforementioned criteria.
Statistical Analysis
All data were expressed as mean ± SEM. The statistical analysis was conducted with one-way ANOVA followed by Tukey test for multiple comparison. Statistical significance was defined as a P value of < 0.05.