Clinical samples
All patients were diagnosed with gliomas at the Department of Neurosurgery, the First Affiliated Hospital of the University of Science and Technology of China. None had received chemotherapy or radiotherapy before surgery. From 2016 to 2019, glioma specimens (n = 42) were obtained during initial surgery. Brain tissues of nonfunctional areas adjacent to the tumors served as controls. After resection, portions of the tumors were sent for routine neuropathological evaluation, and the remaining specimens immediately frozen in liquid nitrogen. All tumors were classified by three neuropathologists using the 2016 World Health Organization criteria. Of the 42 specimens, 12 were low-grade gliomas (World Health Organization grade II) and 30 high-grade gliomas (World Health Organization grades III [13] and IV [17]). Written informed consent was obtained from all patients prior to surgery. All methods and procedures were approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China.
Cell Culture, And Lentivirus Production And Infection
The glioblastoma cell line U251 were obtained from the Anhui Province Key Laboratory of Brain Function and Brain Disease. The use of this line was approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China. Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplemented with 10% (v/v) fetal bovine serum (FBS) (Hyclone, USA) in a humidified incubator at 37°C under 5% (v/v) CO2 [17]. GRK5-upregulated (GV358/GRK5) and GRK5-knockdown (GV248/shRNA Ⅰ, Ⅱ, Ⅲ) lentiviral suspensions were obtained from GenePharma (Shanghai, China). The lentiviruses were packaged in HEK293T cells, and (following the manufacturer’s instructions) were used to infect U251 cells in the presence of 1 µg/mL polybrene (Sigma, USA). Infected cells were cultured to 10% confluence in medium with 5 µg/mL puromycin (Sigma, USA). Untreated U251 cells served as the controls; cells expressing GV358/GRK5; shRNA Ⅰ, Ⅱ, or Ⅲ; or LV3-negative control-GFP were defined as the GRK5-UP, GRK5-KD, and NC groups, respectively. GRK5 expression was evaluated via qRT-PCR and Western blotting [17].
Rna Isolation And Qrt-pcr
Qiagen (USA) RNeasy Mini Kits were used to extract total RNAs from normal brain and glioma specimens, and glioblastoma cells. RNA (2 mg) was reverse-transcribed to cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thremo Fisher, USA). All procedures followed the manufacturers’ instructions. Gene expression was quantified via qPCR using the AceQ SYBR Green Master Mix (Vazyme, China). The fold change in gene expression was calculated using the 2−∆∆Ct method [17, 18]. The primer sequences (all 5ʹ-3ʹ) were:
Human GRK5 real-time PCR forward: AGGAGCTGAACGTGTTTGGA, reverse: TTGTTCTGATGCTGCCGCT; human MSN forward: CCTGAAGGCCCTCACTTCGG, reverse: CTGGCGCAGGGTCTTGTATT; N-cadherin forward: AACAGCAACGACGGGTTAGT, reverse CAGACACGGTTGCAGTTGAC; Bax forward AAACTGGTGCTCAAGGCCC, reverse GTCCTGGAGACAGGGACATC; VEGF forward GAGGAAGAGTAGCTCGCCG-3, reverse CTGGGACCACTTGGCATGG; human GAPDH forward TCGGAGTCAACGGATTTGGT, reverse TTCCCGTTCTCAGCCTTGAC; and β-actin forward ATGGATGATGATATCGCCGCGC, reverse TTTCTCCATGTCGTCCCAGTTGG.
Western Blotting
Western blotting was performed as previously described [9]. Membranes were incubated with polyclonal anti-GRK5 (1:500, BS-1981, Bioworld Technology, USA) and mouse monoclonal anti-MSN (1:500, BF0619, Affbiotech, USA) at 4°C overnight; and with a monoclonal GAPDH antibody (1:1,000, CST 97166, Cell
Signaling Technology, USA) at room temperature for 1 h. Immunoreactive proteins were visualized using an ECL Detection System (BeyoECL Plus, Beyotime, China). Protein band intensities were determined with the aid of Image Pro-Plus version 6.0 (Japan).
Cell Migration Assay
Cells were cultured in 12-well plates and monolayers were scratched with 200-µL micropipette tips when the cells attained 80–90% confluence. At 24 and 48 h, images showing cell migration into the scratches were captured using a camera fitted to an IX71 microscope (Olympus, Japan). Cell migration was quantitated with the aid of Image J software, and was the [mean wound closure area/mean initial wound area] × 100 (%). The experiment was repeated three times [17].
Matrigel Invasion Assay
The invasion assay employed BioCoat Invasion Chambers (BD, USA). After coating the upper chamber with Matrigel, approximately 5 × 104 cells in 200 µL of serum-free DMEM were added to the upper chamber, and 600 µL of DMEM with 10% (v/v) FBS to the lower chamber. After culture for 18 h at 37°C, cells on the upper side of the membrane were removed, and cells on the lower membrane surface fixed in 1% (v/v) paraformaldehyde, stained with 0.1% (w/v) crystal violet, and counted under a light microscope (eight random 200 × fields per insert). The cell counts were averaged. The experiment was repeated three times.
Cell Proliferation Assay
Cell proliferation was measured using a Cell Counting Kit-8 (CCK-8, Dojindo, Japan). Equal numbers of glioma cells were seeded into wells of a 96-well plate. After culture for 48 h, the medium was replaced with medium containing 10% (v/v) CCK-8 solution. After incubation for a further 2 h at 37°C, absorbances at 450 nm were measured. The experiment was repeated three times.
Immunofluorescence Analyses
Double-labeling immunofluorescence followed by confocal laser scanning microscopy (CLSM) was used to detect GRK5, MSN, and CD44 in glioma specimens. Paraffin cross-sections were fixed in formaldehyde, deparaffinized in xylene, rehydrated in PBS, and incubated with 3% (v/v) hydrogen peroxide (to quench endogenous peroxidase activity) for 25 min. After blocking in 10% (v/v) normal goat serum for 1 h, the cross-sections were incubated with rabbit polyclonal anti-GRK5 (1:1,000, BS-1981, Bioworld Technology), mouse monoclonal anti-MSN (1:3,000, BF0619, Affbiotech), and mouse monoclonal anti-CD44 (1:200, CST 3570, Cell Signaling Technology,USA) antibodies at 4°C overnight, followed by incubation with FITC- and TRITC-conjugated secondary antibodies (Beyotime, China) for 1 h at room temperature [19]. All images were obtained using an Olympus CLSM.
Triple Immunofluorescence Analysis
Slides were deparaffinized and antigen retrieval performed by heating the (glue-coated) slides in a microwave oven for 8 min in EDTA buffer (pH 8.0, Servicebio, China). Blocking proceeded for 1 h in buffer with 2.5% (v/v) goat serum and 0.5% (w/v) sodium dodecyl sulfate at room temperature (Vector Laboratories, USA). The slides were then incubated with primary antibodies in the following order: rabbit polyclonal anti-GRK5 (1:1,000, BS-1981, Bioworld), mouse monoclonal anti-MSN (1:3,000, BF0619, Affbiotech), and mouse monoclonal anti-CD44 (1:200, CST 3570, Cell Signaling Technology) overnight in 0.01 M phosphate-buffered saline with 0.5% (w/v) bovine serum albumin and 0.05% (w/v) NaN2. The slides were washed and incubated with secondary antibodies in the following order: horseradish peroxidase (HRP)-labeled goat anti-rabbit fluorescent antibody (1:500, GB23303, Servicebio), HRP-labeled goat anti-mouse fluorescent antibody (1:500, GB23301, Servicebio), and Cy5-labeled goat anti-mouse fluorescent antibody (1:400, GB27301, Servicebio) for 50 min each. Coverslips were mounted using Vectashield mounting medium (Vector Laboratories) and DAPI [20].
Apoptosis Assay
To assess apoptosis, tumor cells were simultaneously stained with Annexin V-PE and the viability dye 7-amino-actinomycin D (7AAD) using an Annexin V-PE/7-AAD Apoptosis Detection Kit (KeyGen Biotech, China) according to the manufacturer’s instructions. Stained cells were immediately detected via flow cytometry (Cell Lab Quanta SC, Beckman Coulter, USA). The experiment was repeated three times.
Statistical analysis
All statistical analyses were performed using SPSS ver. 22.0 software. The independent Student t-test was used to compare gene expression levels between two groups. One-way analysis of variance (ANOVA) was employed to compare gene expression levels among three groups. P-values < 0.05 were considered statistically significant.