Cell culture
The glioblastoma cell lines Glioblastoma Serum-Differentiated Cells (GSDCs), YKL-40 shRNA GSDCs (our lab)29 and U87 (ATCC, USA), gallbladder cancer lines SGC, NOZ and OCUG-1 (the Health Science Research Resources Bank of Osaka, Japan), and macrophage lines RAW264.7 and THP-1 (ATCC, USA) were cultured in DMEM with 10% FBS. Human monocytes THP-1 were differentiated into M0 macrophages in the presence of 150 nM phorbol, 12-myristate, 13-acetate for 24 hr (TPA, Sigma, USA, P8139). The breast cancer line HCC1395 (ATCC) was cultured in RPMI 1640 medium with 10% FBS. CD8+ cytotoxic T cell line TALL-104 (ATCC) was cultured in RPMI 1640 medium with 10% FBS and 3.4 ng/ml IL-2 (Sigma Inc, 110942-02-4). To activate cytotoxicity, TALL-104 cells were added to a plate precoated with an anti-CD3 antibody (5 µg/ml) (Thermofisher, 16-0037-85) for 3 to 5 days in the presence of 2 µg/ml of an anti-CD28 antibody (Thermofiser, 16-0288-85) and 3.4 ng/ml of IL-2. Human microvascular endothelial cell line HMVECs from our lab were grown in endothelial basal medium (Lonza Inc, Germany, CC3156) plus 10% FBS, 10 ng/ml EGF (Sigma Inc, HY-P7109), and 1 µg/ml hydrocortisone (Sigma Inc, HY-N0583).
Cell Fusion
Individual cell populations were incubated with either 2 µM Calcein AM (Cal AM) or Calcein Red (Cal Red) (Thermofisher Inc, C3099 or C34851) for 30 min at 37°C. Cal AM was a cell-permeable dye that is used for determine viable cells, whereas Cal Red was nuclear dye for dead cells. Cells were collected following trypsinization, washed extensively with PBS, and then mixed at the ratios indicated in the text and cultured for 24 hr. Cells were visualized via fluorescence microscopy and images were overlaid and counted. In some cases, cells were labeled with DAPI or BrdU (Thermofisher Inc, 62247 or 00-0103), and cells expressing GFP were directly used for cell fusion assay.
Cell Sorting:
Control or YKL-40 shRNA GSDCs and RAW264.7 cells were mixed (1:3) and cultured for 24 hours. The mixed cultured cells were resuspended and incubated with magnetic Microbeads conjugated with an anti-F4/80 antibody (Miltenyi Biotec, USA, kit 8802-6863-74) for 15 min at 4°C. Then the cell samples were applied to the MACS column in the magnetic field. After column washing and removal from the magnetic field, the F4/80+ cells were collected from the column and were subsequently incubated with a mouse anti-CD68 antibody for 15 min at 4°C. The magnetic Microbeads conjugated with goat anti-mouse IgG (Miltenyi Biotec, 130-048-402) were added to the cell samples for 15 min at 4°C. The final CD68+ cells were identically collected as dual F4/80+/CD68+ fused cells from the MACS column after removal from the magnetic field. These hybrids fused with RAW264.7 cells and control or YKL-40 shRNA GSDCs were planted to 48-well dishes for cell scratch assay.
Time Lapse Fluorescence Microscopy
GSDCs pre-labeled with Cal AM were mixed with RAW264.7 pre-labeled with Cal Red. The mixed cells were then transferred to a six-well plate and kept in a 37°C time lapse incubator with CO2 and monitored over time with a CCD camera attached to a dedicated fluorescence microscope (Essen BioScience Inc, USA). Images of cell movement were obtained continuously for 24 hr period and analyzed using IncuCyte® ZOOM software.
Cell Scratch Assay
Cells were grown in 12-well plates to confluency and then a 200-µl yellow tip was used to make a scratch throughout the middle of the well. The cells were then monitored overnight for migration in serum-free DMEM.
Phagocytosis
24-well cultured cells were incubated in Hank's buffer containing 20 mM HEPES, pH 7.4 at 37°C in the absence of CO2. Pre-sonicated pHrodo™ Red
S. auresas bioparticles (1 mg/ml, ThermoFisher Inc., P36600) were added to the wells and the cells were incubated for 3 hrs. The phagocytosed bacteria in the cells yielded red fluorescence product. The cells were then fixed with 4% para-formaldehyde for 10 min at room temperature and washed with PBS. Nuclei were stained with DAPI and intracellular red fluorescence of these bioparticles resulted from intracellular low pH was monitored with fluorescence microscopy.
Altering B7-2 Expression
A full length of human B7-2 full cDNA 969 bp was cloned via AgeI into a lentiviral plasmid GV209 which independently co-expressed eGFP (Genechemi Inc, China). 293T cells were transfected with a lentiviral DNA packaging system containing 2 µg B7-2 GV209, 1.5 µg Helper 1 vector and 1 µg Helper 2 vector for 6 hr, followed by replacement with 10% FBS DMEM for 48 hr. The resulting viral medium was filtered and used for GSDC infection. Stable GSDC lines engineered to ectopic expression of B7-2 were established by resistance to puromycin (1 µg/ml). A hairpin DNAs carrying B7-2 shRNAs targeting 5’ CTGATGTTACGAGCAATAT 3’ (451–469 bp) (shRNA96), 5’ TGCTCATCTATACACGGTT 3’ (605–623 bp) (shRNA97), 5’ TTTGTAAGTTCCTGGGCAA 3’ (1019–1027 bp) (shRNA98), respectively, were cloned into a lentiviral vector GV493 (Genechemi Inc, China) via Age I and EcoRI, which also separately encoded eGFP. Virus production and cell infection were performed as described above. The final stable lines carrying B7-2 shRNA96, 97 and 98 were selected in the presence of 1 µg/ml puromycin.
Dna Constructs And Luciferase Assay
B7-2 promoter DNA sequence from + 1 upstream to − 672 base pairs was synthesized by Shanghai Hua Gene Biotech Co., Ltd, China. This fragment containing KpnⅠand BglⅡsites was cloned into a pGL3 vector that contains a luciferase reporter cDNA (Promega Inc. USA, P1751). The DNA was then transfected to cells with lipofectamine 3000 transfection reagent (ThermoFisher Inc., L3000008). Briefly, 12-well cells at 80% confluence were incubated with 2 µg of wild type or mutant plasmids in the presence of 4 µl lipofectamine 3000 for 48 hr. The cells were lysed and luciferase activity was measured with a firefly luciferase kit (Promega Inc, E8130).
Chromatin Immunoprecipitation (Chip)
Cells were treated with 1% formaldehyde for 10 min at room temperature to cross link DNA and protein and were then subjected to sonication on ice for 45 seconds. The samples were then incubated with an anti-CREBZF antibody (Abcam Inc, USA, Ab28700) at 4°C overnight. The CREBZF-antibody-DNA complexes were extracted by adding protein A/G-Sepharose beads (ThermoFisher Inc., 20423) at 4°C for 4 hr. After washing, the complexes were denatured at 100°C for 10 min. Bound DNA was purified using phenol/chloroform/isoamyl alcohol (ThermoFisher Inc., 15593031) and subjected to PCR using primers (forward) 5’ CTATGTTTGTCTCTTAGGGAC 3’ and (reverse) 5’ TCCTCGGCAATGACTGTATAC 3’ that amplified B7-2 promoter WT or MT.
Immunoblotting And Immunoprecipitation
Cells were lysed with lysis buffer containing 6.52 mg/ml HEPES, 0.42 mg/ml NaF, 8.64 mg/ml NaCl, 0.2 mg/ml MgCl2, 5% NP-40 and 1x protease inhibitor (ThermoFisher Inc., 87786). Following incubation on ice for 20 min, the samples were centrifuged at 10,000g at 40C and the supernatants were subjected to SDS-PAGE on a 10% gel. PVDF membranes (VWR Inc, USA) were incubated with one of a series of primary antibodies against YKL-40 (our lab), Vimentin (DSHB Inc, USA, AMF-17b), E-cadherin, N-cadherin (ThermoFisher Inc. 33-4000, 33-3900), EGFR, integrin β3, Akt, pAkt (Cell Signaling Inc, USA, 2232, 13166, 9272, 9271), Arg-1, Erk 1/2, pErk 1/2, NF-kB p50, p65 (Santa Cruz Inc., USA, SC-18351, SC-94, SC-1383, SC-7178), smooth muscle alpha actin (SMa), IL-13 receptor α2 (IL-13Rα2), CCR2, B7-2, CREBZF, GAPDH (Abcam Inc. Ab5694,Ab55275,Ab155321, Ab243887, Ab28700, Ab8245), casp3 (Enzo Life Science Inc., USA, ADI-AP-113) and actin (Sigma Inc., A0480). For immunoprecipitation, cells were lysed with buffer containing 1M Tris, 5M NaCl, 0.84 mg/ml NaF, 0.037 mg/ml Na3VO4, 0.38 mg/ml EGTA, 0.37 mg/ml EDTA, 0.034 mg/ml PMSF, 1% Trion 100X and 0.5% NP40. After centrifugation, the supernatant samples were incubated with an anti-IL-13Rα2 monoclonal antibody followed by adding protein G Sepharose 4 Fast Flow beads (ThermoFisher Inc., 101242) at 4°C for 4 hrs. The immunocomplex was extensively washed with lysis buffer and the samples were used for immunoblotting using an integrin β3 or N-cadherin antibody as described above.
Immunocytochemistry
Cells were grown to sub-confluency and fixed with 4% para-formaldehyde for 5 min at room temperature. Following permeabilization with 1% Triton 100X, the cells were incubated with an antibody against CD68 (DakoInc, USA, M8014), EGFR (Cell Signaling Inc., 2232), BrdU, F4/80 (ThermoFisher Inc, 33900, MF48000), actin (Sigma Inc, A0480), or tubulin (Millipore Inc, MAB1637) (all primary antibodies 1:100–200) at 4°C overnight followed by incubation with a goat anti-mouse or rabbit Alexa Fluor 488 or 555 antibody (1:1000, ThermoFisher Inc, A11008, A21422) for 2 hr. Cell nuclei were stained with DAPI. For dual labeling, one primary and secondary antibody staining was followed by incubation with separate primary and secondary antibodies. The resulting fluorescent images were quantified with NIH ImageJ software.
Cell Cytometry For Cell Cycle Analysis And Cell Apoptosis
Cells were fixed with 70% ethanol at 4°C for 4–6 hr and then incubated with 20 µg/ml ribonuclease A and 1 mg/ml propidium iodide (Sigma Inc) for 30 min before application for cell cycle analysis using a BD Facscan and ModFit LT 5.0 software (Attune NxT, USA). Propidium iodide-stained chicken erythrocytes were used as a standard for diploid DNA content. Cells were fractionated based on DNA content and cells with a ploidy greater than 6n were collected and immunostained with an anti-tubulin antibody (Abcam Inc). For apoptosis assay, cells were treated with 5 µl Annexin V–FITC (100 µg/ml) (ThermoFisher Inc, 331200) and 5 µl PI (100 µg/ml, 10797) followed by flow cytometry analysis using FlowJo v.10.0.7 software.
Rt-qpcr
Cellular total RNA was isolated using Tri-reagent (Sigma Inc). RT-Master Mix (Takara Bio, Dalian, China) was employed for cDNA synthesis and then samples were subjected to real-time PCR detection analysis (Roche Inc, USA) with a SYBRO green-based PCR method for INF-γ, T-bet, Perforin, Granzyme B and TNF-α mRNA gene expression using the primers listed in Table S1. All reactions were performed in triplicate. Gene expression levels were normalized to GAPDH expression. Relative target gene expression levels were calculated using the comparative cycle threshold method.
Gene Microarray
Total RNA from single clone GSDCYKL−H and GSDCYKL−L was isolated using Tri-reagent (Sigma Inc). 1 µg of each sample RNA was used to synthesize Cy-3-labeled cRNA for running Agilent Whole Human Genome Microarray 4×44K (Shanghai Biotechnology Corporation, China), which contained 41,000 human genes or transcripts. The microarray slide was incubated at 65°C for 17 hours in a hybridization oven, model G2545A (Agilent Technologies, USA), washed three times at 25°C, and then scanned using a Gene Chip Scanner. Feature Extraction software (Agilent Technologies) was used to extract the scanned data of each microarray slide. GeneSpring GX software (Agilent Technologies) was used to analyze gene expression and the quantile normalization method was used to normalize the chip data. Welch’s t-tests and the Significance Analysis of Microarrays (SAM) tests were used to identify genes that were differentially expressed and fold-values > 2.0 were filters for screening genes.
Animal Models
All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Shanghai Jiao Tong University School of Medicine. For brain orthotopic transplantation, cells (50 ×103 cells/5 µl of PBS) were injected into right striatum of 4-week-old female nude mice (n = 6/group) (Nanjing University, China). Mice were killed with CO2 when mice displayed decreased locomotion, which was typically 9–12 weeks after transplantation. For TALL cell implantation, mice were injected with TALL cells (1×106 cells) via tail vein injection one month after initial GSDC transplantation into the striatum (150 x103 cells/5 µl of PBS). Animals were observed for 18 weeks.
Immunohistochemistry And Immunofluorescence
All human patient cancer samples were collected with the approval of the Institutional Review Board of Xinhua Hospital and Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine. This retrospective study included 52, 9 and 38 cases of GBM, gallbladder cancer (GBC) and breast infiltrating ductal carcinoma (IDC), respectively, after exclusion of some cases that lacked medical records or had secondarily diagnosed cancers. All of the enrolled patients accepted informed consent prior to tissue acquisition during surgery. Paraffin-embedded tumor tissues were sectioned to 6 µm thickness and processed for immunohistochemical analysis. In brief, samples were incubated with 3% H2O2 for 30 min at room temperature to block endogenous peroxidase activity followed by incubation with blocking buffer containing 10% goat serum for 1 hr. The samples then were incubated for 2 hr with antibodies against YKL-40 (our Lab), CD68 (Dako Inc, M0814) or B7-2 (Abcam Inc, Ab243887). A goat anti-rabbit, mouse or rat secondary antibody (1: 100, Dako Inc) conjugated to HRP was added for 1 hr. Finally, DAB substrate (Dako Inc) was introduced for several minutes and after washing, methyl green was used for counterstaining. For single and dual immunofluorescent staining, tumor specimens were incubated with mouse or rabbit antibodies against YKL-40 (our Lab), EGFR (Cell Signaling, Inc), vimentin (DSHB Inc) or CD68 (Dako Inc) for 2 hr followed by incubation with a goat anti-mouse or rabbit Alexa Fluor 555 or 488 secondary antibody (1:250) for 1 hr. Finally, DAPI was added to stain the nucleus. For quantification of YKL-40 and CD68 staining, a semi-quantified assay with combined scores of percent and intensity of positive staining was used for percent staining30: no staining is 0 points; <10% of cells stained is 1 point; 11–50% of cells stained is 2 points; and > 50% of cells stained is 3 points; for intensity staining: no staining is 0 points, weak staining is 1 point, moderate staining is 2 points and strong staining is 3 points. Therefore, strong staining the score > 4, medium staining 3–4 and weak staining <3.
Statistics
Data are expressed as mean ± SEM, and n refers to the numbers of individual experiments performed. The significance of a Kaplan-Meier survival plot was determined by log-rank analysis. Differences among groups were determined using one-way ANOVA analysis. The 0.05 level of probability was used as the criterion of significance.