Clinical specimen and data collection. Human glioma specimens were collected from the inpatients in Department of Neurology, Renmin Hospital of Wuhan University from 2015 to 2017. This study was reviewed and approved by Medical Ethics Committee of Wuhan University. Written informed consent was obtained from each patient included. Normal contral brain tissue that corresponds to glioma tissues were taken from patients undergoing surgical treatment for craniocerebral trauma.
Immunohistochemistry (IHC) and evaluation. The IHC was performed as described previously[13]. LRIG1-positive cells displayed brownish blue granules on the cytoplasm. According to the percentage of immunoreactive cells and intensity of the staining, cell were divided into four parts from + to ++++ through immunohistochemical scores (IHC scores). The percentage was rated on a scale of 0–4 as follows: 0, < 5%; 1, 5–25%; 2, 26–50%; 3, 51–75%; and 4, 76–100%. The evaluation of the staining intensity was rated and scored as follows: 0, no staining; 1, weak staining; 2, moderate staining; and 3, strong staining. By multiplying the percentage and intensity score we obtained the IHC score. The final grouping criteria was as follows: IHC scores 0–3 were considered as group +, scores 4–6 were considered as group ++, scores 7–9 were considered as group +++ and scores 10–12 were considered as group ++++. These scores were independently determined by two independent senior pathologists. Group + and group + + were considered as low expression, group +++ and group ++++ were considered as high expression.
Cell culture and PCPA treatment. The human glioma cell line U-251 MG was purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cell was cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) (Hyclone, Logan, UT, USA) under a humidified atmosphere with 5% CO2 at 37˚C. Normally, the medium was replaced every 2 or 3 days. Cells were passaged every 5 days or 6 and routinely examined. PCPA (Aladdin Biochemical Technology, Shanghai, China) is prepared as 50 mmol/L PCPA solution dissolved in ultrapure water, and stored at 4 ℃ for further use. The final concentration of PCPA was 100 µmol/L when the cells were treated for further qRT-PCR, Western blot or cell invasion and migration assay.
RNA isolation and qRT-PCR. Total RNA were extracted from fresh frozen glioma tissues or glioma cell line using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. One µg of total RNA was used as a template for reverse transcription using ReverTra Ace-A (Toyobo, Osaka, Japan), after the determination of the amount of total RNA by ultraviolet (UV) spectrophotometry. Oligonucleotide primer sequences used were as follows: LRIG1 sense 5’CCGGGTGATACAACCTTGCT3’ and antisense 5’ACACCGAAGTGGACTGTTACTCC3’; SNAI2 sense 5’CCCAGGCTCACATATTCCTTGT3’ and antisense 5’ACACCGAAGTGGACTGTTA CTCC3’; E-cadherin sense 5’ATAGTTCGAGGTTCTGGTATGGG3’ and antisense 5’ACTGGTGCCATTTCCACTCG3’; GAPDH sense 5’GTCCACCGCAAATGCTTCTA3’ and antisense 5’TGCTGTCACCTTCACCGTTC3’. RT-PCR was performed to quantify the mRNA expression using the SYBR-Green PCR Master Mix (Takara). Glyceraldehyde-3-phosphate dehydrogenase(GAPDH) was used as reference for mRNA and each sample was analyzed in triplicate.
Transfection of plasmid. The pLRIG1-GFP, which was kindly donated by Dr Jianming Liao (Department of Neurosurgery, Renmin Hospital of Wuhan University), is a mammalian expression vector carrying a GFP‐coding sequence upstream from its cloning sites. U251 cells were transfected with pLRIG1-GFP using LipofectamineTM 2000 (Invitrogen) according to the manufacturer’s instructions. The empty vector p-EGFP-N1 was transfected into U251 cells for control. Cell clones resistant to G418 for 3 weeks were ring-cloned and amplified for further experiments.
Western blot analysis. Total protein of glioma tumor tissues or glioma cell line was extracted using RIPA buffer supplemented with proteinase inhibitors. The primary and secondary antibodies used in this work were as follows: polyclonal rabbit anti-LRIG1 (1:1000; Abcam, Cambridge, USA); monoclonal rabbit anti-GAPDH (1:10000; Abcam, Cambridge, USA); polyclonal rabbit anti-SNAI2 (1:1000; Cell Signaling Technology, Boston USA); polyclonal rabbit anti-E-cadherin (1:1000; Cell Signaling Technology, Boston USA) and HRP labelled goat anti-rabbit IgG (1:10000; Santa Cruz Biotechnology, USA). The intensities of bands were semiquantified by using densitometry.
Cell invasion and migration assay. The cell invasion was performed with 8-µm pore size Transwell chambers (Corning, Corning, NY, USA) precoated with matrigel (R&D Systems, Minneapolis, MN, USA). Cells were suspended in serum-free DMEM. Then, 5 × 104 cells in 100 µl of serum-free DMEM were plated into the upper chamber and 600 µl of DMEM containing 10% FBS in the lower chamber. These chambers were cultured at 37℃ with 5% CO2 for 36 h. The cells in the upper chamber were collected with a cotton swab and cells that had adhered to the lower surface were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet and counted under a microscope (Olympus BX51). The migration assay had the same steps except that the absence of matrigel and the cells were cultured for 24 h.
Scratch test. 5 × 105 cells in 1 ml of DMEM containing 10% FBS were plated into 6-well plate. These plates were cultured at 37℃ with 5% CO2 and observed under inverted microscope (Olympus). Remove the culture solution when the cells are spread over the bottom of the 6-well plate. Scratch from top to bottom in the center of the 6-well plate perpendicularly with a sterile 200 µl gun head and wash the cells with 2 ml PBS solution for 5 times. Then observe and record the scratch width at 0 h and 24 h under the inverted microscope and take photos. Cell migration ability is expressed as (0 h scratch width − 24 h scratch width) / time.
Statistical analysis. T-test or one-way analysis of variance (ANOVA) was employed to analyze the significant differences between groups. Significant difference between clinicopathological characteristics of glioma tissues were determined with Chi-square Test. Survival was analyzed by the Kaplan-Meier survival curve. The aforementioned statistical tests all performed with GraphPad Prism 6.0 version (GraphPad Software, Inc., La Jolla, CA, USA) and comparisons were two-tailed and p༜0.05 was considered significant.