Bacterial Isolates
Clinical E. faecalis isolates that were previously collected from Hospital Kuala Lumpur (HKL) Malaysia were used in this study (Table 1).
Table 1 E. faecalis isolates in this study
E. faecalis
|
|
|
|
Characteristics
|
EF1 EF2 EF2r
|
|
|
|
E. faecalis isolated from pus sample
E. faecalis isolated from blood sample
E. faecalis EF2 that became resistant to ampicillin after exposure to biocide
|
Media, Biocides, And Antibiotics
Brain heart infusion (BHI) and Muller Hinton (MH) agar and broth were from Oxoid, UK. Biocides that were used in this study included ethanol (100% v/v) (Sigma, Germany), hydrogen peroxide (50% v/v (Sigma, Germany), sodium hypochlorite (50% w/v) (Sigma, Germany), and chlorhexidine digluconate (20% w/v) (Sigma, Germany). Antibiotics ampicillin (10 µg), vancomycin (30 µg), gentamicin (120 µg), teicoplanin (30 µg), linezolid (30 µg), and nitrofurantoin (300 µg) were purchased from Oxoid, UK.
Determination Of Biocides MICs
MICs of biocides were determined using broth microdilution method as recommended by the CLSI guidelines [16]. Isolates were grown on BHI agar plates for 18–24 h at 37 °C. Colonies were suspended in 0.9% NaCl to an OD600 between 0.08 and 0.13 or turbidity equivalent to that of a 0.5 McFarland standard. The suspended colonies were then diluted to 100-fold in MH broth. Biocides from stock solutions were 2-fold diluted in 96-wells plate with 50 µl of biocide solution in each well. After the dilution series, 50 µl of biocide working solutions and 50 µl of cell suspension were pipetted into the 96-well microtiter plates and were incubated aerobically at 37 °C for 16–20 h. The MICs were defined as the lowest concentration of the compounds that produce no visible growth of bacteria. Measurements were carried out in triplicates.
Exposure To Sub-inhibitory Concentrations Of Biocides
Isolates were exposed to sub-inhibitory concentration of biocides (determined as MIC/2) during mid-logarithmic phase (2 h) incubation in (5 ml) MH broth. The optimum exposure time was determined using growth profiles (data not shown). The isolates were left to grow for another 2 h at 37 °C under shaking condition (180 rpm) prior to antibiotic susceptibility testing.
Antibiotics Susceptibility Testing
Antibiotics susceptibility testing were determined using disk diffusion and broth microdilution methods in MH agar and broth, respectively as recommended by CSLI, 2016. For disk diffusion, the inhibition zone was measured after 18–20 h incubation at 37 °C. The broth microdilution was done in 96-wells plates [17]. Two-fold serial were prepared and inoculated plates were then incubated for 16–20 h at 37 °C. MICs were determined as the lowest concentration of antibiotics that produce no visible growth of bacteria as measured by Microplate Reader (Dynex MRX TC). Experiments were performed in triplicates and on three separate occasions.
Determination Of Bacterial Morphology And Ultrastructure
The morphology and ultrastructure of exposed and non-exposed isolates to biocides were observed using scanning (JEOL 6400 SEM) and transmission electron microscope (Hitachi H- 7100 STEM). Specimens were prepared according to [18] and then dried in critical point dryer before coated with gold in sputter coater and viewed under scanning electron microscope. Prior to viewing under transmission electron microscope, the cells were sectioned (thick and ultrathin) using glass knife and ultramicrotome, followed by staining with uranyl acetate and lead stain. The cells were examined under 3500x-8000x magnifications.
Screening And Detection Of Ampicillin Resistance Genes
Multiplex PCR amplification was performed to screen for genes responsible for ampicillin resistance using sets of primers as listed in Table 2. The PCR reaction mixture (25 µl) was prepared by mixing 12.5 µl of EconoTaq® PLUS GREEN 2x PCR master mix, 0.25 µl of both forward and reverse primers for each sample to make a total of 2 µl each, 1.0 µl of DNA template and 9.5 µl of RNase free water. The PCR protocol were as follows: initial denaturation step of 94 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 52 °C for 1 min, elongation at 72 °C for 2 min and a final elongation step at 72 °C for 10 min with 4 °C as holding temperature. All PCR products were purified and sequenced.
Table 2
Primers for PCR amplification of targeted genes
Primer | Sequence (5’-3’)` | Amplicon | Size (bp) |
Pbp5-F Pbp5-R | AGTGGCGGTTATTTTTACTA ACCGTCTGTATCTGTGAGGC | pbp5 | 900 |
BlaZ-F BlaZ-R | ACTTCAACACCTGCTGCTTTC TGACCACTTTTATCAGCAACC | blaZ | 173 |
pbp4 718F pbp4 1486R | TTTGTACCAATCACAGTTG CCCCCATCCGTAATGTTTG | pbp4 | 769 |
*pbp4 140F *pbp4 1132R | CAACGAAAGCCTGATGAAATGG AATCGCCTTTTTGAGGATCGG | pbp4 (confirmatory) | 1272 |
*pbp4 1043F *pbp4 2130R | CGATTGACAGTGTACAACAACAAGC CGCTTCATTGTAGCACACTTTCCTTTTTC | pbp4 (confirmatory) | 1087 |
After screening by multiplex PCR, the presence of pbp4 gene in E. faecalis was further confirmed by single PCR amplification using the starred primers. |
Data Analysis
The data analysis for the percentage of cultures with reduced susceptibility in antibiotics was done using Statistical Package (SPSS). The sequences were analyzed using multiple sequence alignment (ClustalW) and BLASTn.