In this work, HBTU and NMM were from Alfa Aesar (England); DIPEA was from Fluka (Germany); DMF, AcOEt, iPrOH, and NH4OH were from Reakhim (Russia). Poly(dA-dT)*poly(dA-dT) and Poly(dG-dC)*poly(dG-dC) from Sigma (USA). Organic solutions were dried with Na2SO4. The solvents were evaporated in vacuum of a water-jet pump at 30–50°C. The compounds were dried in vacuum with P2O5 and NaOH. Melting points are uncorrected and were measured on a Boethius apparatus (Germany). Hydrogenation was carried out in the presence of 10% Pd/C (Merck, Germany) at atmospheric pressure and room temperature until hydrogen evolution was stopped. The compound purity was determined by TLC on Kieselgel 60 F254 plates (Merck, Germany) in the following systems: A, MeOH-conc.NH4OH (25:1); B, MeOH-TFA-H2O (5:1:2). The compounds were visualized using UV irradiation (254 nm) and/or by fluorescence at 365 nm. 1H and 13C NMR spectra were registered using an Avance III 300 MHz spectrometer (Bruker, Germany) and Bruker Avance III 800 MHz spectrometer (Bruker, Germany), equipped with the triple resonance TCI cryogenic probe (Bruker Biospin Gmbh, Germany) in DMSO-d6 at 30°C. Chemical shifts (δ) are given in ppm relative to the resonances of solvents (1H, δ 2.50 for DMSO-d6; 13C, δ 39.52 for DMSO-d6). .Hydrogen atoms of benzimidazole cycles are defined as (Ar), N-H group of benzimidazole, as (bim), and piperazine, as (pip). Mass spectra were registered on a time-of-flight AB SCIEX 4800 plus mass-spectrometer (AB SCIEX, United States) in the positive ion mode; 2,5-dihydroxybenzoic acid was used as a matrix.
Spectral measurements
UV-vis absorption spectra were recorded on a Shimadzu UV-3101 PC spectrophotometer (Japan) in the range from 250 to 650 nm in quartz cells with an optical pathlength of 1 cm, unless otherwise noted. Stationary fluorescence measurements were performed on a FluoTime 300 fluorimeter, a Xe lamp was used as an excitation source (350 nm). The binding constant was determined by the hyperbolic function from the equation for approximating the dependence of the fluorescent signal intensity on the polydeoxyribonucleotide concentration [24]. The binding constants of DB3P(n) with polydeoxyribonucleotides were determined using fluorescence spectroscopy. The binding constant Kb was calculated from the curves in accordance with the formula (1) [24]:
Θ = (Kb [DNA]) / (1 + Kb [DNA]) (1)
where Θ = (F - F0) / (F∞ - F0) is the proportion of the dye associated with the polydeoxyribonucleotide; F0, F∞ and F are the fluorescence intensities at [DNA] = 0 and at complete and intermediate binding of DB3P(n) to polydeoxyribonucleotide, respectively. CD spectra were recorded on a portable SKD-2 dichrometer (Troitsk, Russia). DNA from salmon sperm (Derinat, Russia) was used.
Experimental Section
4-[6-(4-Methylpiperazin-1-yl)-1H-1,3-benzodiazol-2-yl]-2-nitroaniline (III). Ethyl 4-amino-3-nitrobenzene-1-carboximidate *2 HCl (II) (3.83g, 15.6 mmol) [17] was added to a solution of 5-(4-methylpiperazin-1-yl)benzene 1,2-diamine (I) [14] in AcOH (50 mL) obtained from 5-(4-methylpiperazin-1-yl)-2-nitrophenylamine (3.74g, 15.6 mmol) and the reaction mixture was refluxed for 1 h. The precipitate was filtered off, washed with AcOH until the filtrate was colorless. The yellow solid was dissolved in a minimal volume of hot water and concentrated NH4OH was added up to a highly alkaline pH. The precipitate was filtered off and dried to give 2.53 g (46%) of compound (III) as red brick powder. Rf 0.60 (А), mp 1520С. 1Н NMR (300 MHz, DMSO-d6,): 2.26 (3Н, s, N-CH3), 3.13 (4H, m, pip), 7.01 (3H, m, ArH), 7.39 (1H, dd, J 8.6, J 34.7, ArH), 7.74 (2H, br s, -NH2), 8.14 (1H, m, ArH), 8.75 (1H, dd, J 1.8, J 9.9, ArH), 12.59 (1H, s, bimNH)
(4-[6-(4-Methylpiperazin-1-yl)-1H-1,3-benzodiazol-2-yl]benzene-1,2-diamine IV). Hydrogen was intensively passed via a suspension of 10% Pd/C (25 g) in AcOH until the absorption was completed and a solution of compound (III) (2.53 g, 7.18 mmol) in AcOH (30 mL) was added. Hydrogen was passed through the mixture for 2.5 h (TLC monitoring, 25:1 EtOH/NH4OH). The reaction mixture was filtered off and the filtrate was evaporated. Concentrated NH4OH (50 mL) was added to the resulting oil and the mixture was kept at 40С overnight. The precipitate was filtered off and dried to give compound (IV) (2.12 g, 92%), Rf 0.52 (А), mp 156–1590С. 1Н NMR (300 MHz, DMSO-d6): δ 2.24 (3Н, s, N-CH3), 3.09 (4H, m, pip), 4.62 (2H, br.s, -NH2), 4.88 (2H, br.s, -NH2), 6.59 (1H, d, J = 7.95, ArH), 6.84 (2H, dd, J 1.8, J 8.7, ArH), 7.16 (1H, dd, J 1.2, J 8.1, ArH), 7.34 (2H, d, J 1.65, ArH), 12.06 (1H, s, bimNH).
4-{6-[6-(4-Methylpiperazin-1-yl)-1H-1,3-benzodiazol-2-yl]-1H-1,3-benzodiazol-2-yl}-2-nitroaniline (V). A solution of imidoester dihydrochloride (II) (1.62 g, 6,6 mmol) [17] and diamine (IV) (2.12 g, 6.6 mmol) in a 1 : 1 EtOH–2,2,2-trifluoroethanol mixture (80 mL) was refluxed for 3 h. the precipitated was filtered and conc. NH4OH (50 mL) was added. The orange precipitate was filtered off and dried to give compound (V) (1.26 g, 41%), Rf 0.41(А) mp 2400С. 1H NMR (300 MHz, DMSO-d6): δ 2.24 (3H, s, N-CH3), 3.12 (4H, m, pip), 6.93 (1H, dd, J = 1.5, J = 9, Ar), 7.01 (1H, s, ArH), 7.20 (1H, d, J = 8.6, ArH), 7.44 (1H, d, J = 8.7, -NH2), 7.67 (1H, d, J = 8.4, ArH), 7.84 (2H, brs, -NH2), 8.02 (1H, d, J = 8.5, ArH), 8.25 (1H, dd, J = 1.5, J = 8.9, ArH), 8.30 (1H, s, ArH), 8.88 (1H, d, J = 8.5, ArH).
4-{6-[6-(4-methylpiperazin-1-yl)-1H-1,3-benzodiazol-2-yl]-1H-1,3-benzodiazol-2-yl}benzene-1,2-diamine (VI). Hydrogen was intensively passed via a suspension of 10% Pd/C (0.12 g) in AcOH (20 mL) until the absorption was completed and a solution of 2-nitroaniline (V) (1.26 g, 2.7 mmol) in AcOH (30 mL) was added. Hydrogen was passed through the mixture for 2.5 h (TLC monitoring, 25:1 EtOH/NH4OH). The reaction mixture was filtered off and the filtrate was evaporated. Concentrated NH4OH (50 mL) was added to the resulting oil and the mixture was kept at 4⁰С overnight. The precipitate was filtered off and dried to give compound (XII) as gray powder (1,13 g, 95%), Rf 0,45 (А), mp 2340С. Mass: 438.49, calc.: 438.52 (C25H26N8), 1Н NMR (300 MHz, DMSO-d6): δ 2.24 (3Н, s, N-CH3), 3.13 (4H, m, pip), 4.69 (2H, br.s, -NH2), 5.01 (2H, br.s, -NH2), 6.63 (1H, d, J = 8.1, ArH), 6.92 (1H, d, J = 7.9, AHr), 6.99 (1H, m, ArH), 7.27 (1H, dd, J = 7.9, J = 0.6, -NH2), 7.44 (1H, d, J = 1.8, ArH), 7.49 (2H, m, ArH), 7.94 (1H, d, J = 8.1, ArH), 8.20 (1H, s, ArH), 12.55 (2H, brs, bimNH)
Tert-butyl N-{[(2-amino-5-{6-[6-(4-methylpiperazin-1-yl)-1H-1,3-benzodiazol-2-yl]-1H-1,3-benzodiazol-2-yl}phenyl)carbamoyl]methyl}carbamate (VII). A mixture of Boc-Gly-OH (0.49 g, 2.8 mmol) in abs. DMF (10 mL) and NMM (0.5 mL) was cooled under stirring to − 25 ºС and i-BuOCOCl (0.35 g, 2.57 mmol) was added. A solution of diamine (VI) (1.13 g, 2.57 mmol) in abs. DMF (15 mL) preliminarily cooled to − 30 ºС was added to the reaction mixture in 10 min. The mixture was kept at − 30 ºС for 1.5 h, slowly heated to room temperature, and evaporated to give compound (VII), which was used without further purification.
Monomeric trisbenzimidazole MB 3 . A solution of compound (VII) in AcOH (30 mL) was refluxed for 10 h, evaporated, and the resulting oil was diluted with conc. NH4OH (30 mL). The mixture was kept for 4 days at 40С and the grey powder without further purification was dissolved in conc. HCl. The mixture was refluxed for 5 h and poured into iPrOH (100 mL). The precipitate was filtered and purified by column chromatography on silica gel 40–63 µ eluting with 25 : 1 MeOH/NH4OH to give MB3 as light brawn powder (0.41 g, 33.46% over 3 stages), Rf 0.14 (А); Rf 0.68 (B), mp > 3500С. Mass: 477.59, calc.: 477,56 (C27H27N9). 1Н NMR (300 MHz, DMSO-d6): δ 2.26 (3Н, s, N-CH3), 2.54 (4H, m, pip), 3.14 (4H, m, pip), 4.09 (2H, s, CH2), 6.95 (2H, m, ArH), 7.45 (1H, d, J = 8.4, ArH), 7.70 (2H, m, ArH), 8.02 (1H, d, J = 6.7, ArH), 8.08 (1H, dd, J = 0.75, J = 8.3, ArH), 8.32 (1H, s, ArH), 8.39 (1H, s, ArH). 13C NMR (300 MHz, DMSO-d6): δ 36.65, 42.48, 46.39, 52.57, 98.79, 113.82, 114.59, 115.30, 115.66, 116.93, 117.59, 117.74, 119.45, 123.25, 124.78, 125.92, 133.01, 133.58, 135.86, 138.63, 140.25, 147.35, 148.91, 151.68, 152.38
General Procedure For Preparation Of Compounds Dbp(1–4)
To a solution of 1,4-piperazine dialkylcarbonic acids dihydrochloride (0.1 mmol) [16] in abs. DMF (2 mL) HBTU (0.25 mmol) and DIPEA (0.50 mmol) were added. The mixture was stirred at room temperature for 30 min and MB3 (0.10 g, 0.2 mmol) was added. The mixture was stirred for 1 h and kept overnight at room temperature. The solvent was evaporated and the residue was treated with abs. ethanol to give a suspension. A solution of 35% HCl in dioxane (0.5 mL) was added and the precipitate, a yellow bulk powder, was filtered and dried in vacuum with NaOH/P2O5. The target DB3P(n) was homogeneous according to TLC data (system B).
DB 3 P(1).10HCl: Yield 137 mg (92%,), mp > 3500С, Rf 0.40 (В), λmax 340 nm (ε340 21 800 M− 1 cm− 1). Mass, m/z: 1121,56 [M + H]+, calc. М 1121.30 (C62H64N20O2). 1Н NMR (800 MHz, DMSO-d6): δ 2.85 (6H, s, N-CH3), 3.23 (8H, m, CH2-Pip-CH2), 3.42 (s, -CH2-), 3.55 (8H, m, Pip), 3.88 (8H, m, Pip), 4.81 (4H, s, bim-CH2), 7.26 (4H, m, ArH), 7.68 (2H, m, ArH), 7.89 (4H, m, ArH), 8.30 (4H, m, ArH), 8.55 (t, J = 6.6, CONH), 8.70 (4H, m, ArH). 13C NMR (800 MHz, DMSO-d6): δ 36.65, 42.48, 46.39, 52.57, 98.79, 113.82, 114.59, 115.30, 115.66, 116.93, 117.59, 117.74, 119.45, 123.25, 124.78, 125.92, 133.01, 133.58, 135.86, 138.63, 140.25, 147.35, 148.91, 151.68, 152.38
DB 3 P(2).10HCl: Yield 135 мг (89%), mp > 3500С, Rf 0.36 (В), λmax 340 nm (ε340 21 600 M− 1 cm− 1). Mass, m/z: 1149.39 [M + H]+, calc. М 1149.35 (C64H68N20O2). 1Н NMR (800 MHz, DMSO-d6): δ 2.87 (6H, s, N-CH3), 3.22 (8H, m, CH2-Pip-CH2), 3.42 (m, -CH2-), 3.51 (m, -CH2-), 3.56 (8H, m, Pip), 3.88 (8H, m, Pip), 4.74 (4H, s, bim-CH2), 7.21 (2H, m, ArH), 7.30 (2H, m, ArH), 7.70 (2H, m, ArH), 8.18 (2H, m, ArH), 8.32 (4H, m, ArH), 8.62 (4H, m, ArH, CONH), 9.13 (2H, m, ArH). 13C NMR (800 MHz, DMSO-d6): δ 30.34, 36.95, 42.48, 46.78, 48.78, 52.11, 52.68, 99.56, 112.58, 114.02, 114.83, 115.37, 117.31, 117.96, 122.74, 123.64, 124.45, 126.99, 133.82,135.53, 136.73, 148.93, 149.25, 154.51, 154.73, 170.62
DB 3 P(3).10HСl: Yield 143 mg (93%), mp > 3500С, Rf 0.30 (В), λmax 340 nm (ε340 21 400 M− 1 cm− 1). Mass, m/z: 1177.41, calc. М : 1177.41 (C66H72N20O2). 1Н NMR (800 MHz, DMSO-d6): δ 2.05 (m, -CH2-), 2.47 (m, -CH2-), 2.86 (6H, s, N-CH3), 3.23 (8H, m, CH2-Pip-CH2), 3.55 (8H, m, Pip), 3.88 (8H, m, Pip), 4.82 (4H, s, bim-CH2), 7.18 (2H, m, ArH), 7.30 (2H, m, ArH), 7.66 (2H, m, ArH), 7.92 (4H, m, ArH), 8.26 (2H, m, ArH), 8.66 (2H, m, ArH), 8.70 (t, J = 4.6, CONH), 9.09 (4H, m, ArH). 13C NMR (800 MHz, DMSO-d6): δ 19.40, 31.16, 32.12, 36.33, 42.44, 46.63, 48.30, 52.61, 55.54, 99.23, 113.90, 114.69, 115.24, 115.47, 116.17, 117.56, 118.12, 123.44, 124.55, 124.99, 126.29, 132.77, 133.31, 134.22, 138.00, 140.39, 148.44, 149.07, 153.36, 154.93, 172.85
DB 3 P(4).10HCl: Yield 147 mg (94%), mp > 3500С, Rf 0.32 (В), λmax 340 nm (ε340 21 100 M− 1 cm− 1). Mass, m/z: 1205.43, calc. М : 1205.46, (C68H76N20O2). 1Н NMR (800 MHz, DMSO-d6): δ 1.63 (m, -CH2-), 1.71 (m, -CH2-), 2.38 (m, -CH2-), 2.87 (6H, s, N-CH3), 3.23 (8H, m, CH2-Pip-CH2), 3.55 (8H, m, Pip), 3.87 (8H, m, Pip), 4.78 (4H, s, bim-CH2), 7.18 (2H, m, ArH), 7.29 (2H, m, ArH), 7.67 (2H, m, ArH), 7.89 (4H, m, ArH), 8.24 (2H, m, ArH), 8.40 (2H, m, ArH), 8.69 (4H, m, ArH, CONH), 9.02 (2H, m, ArH). 13C NMR (800 MHz, DMSO-d6): δ 22.24, 23.09, 34.61, 36.34, 42.49, 46.65, 47.85, 52.64, 99.38, 113.88, 114.72, 114.85, 115.22, 115.69, 116.18, 117.47, 117.58, 117.94, 123.26, 124.81, 126.42, 133.42, 134.50, 138.57, 140.92, 148.73, 149.03, 153.67, 154.86, 173.52
Antivirus activity DB3P(n) and MB3 against HIV-1
Preparation of Recombinant Integrase
The recombinant HIV-1 integrase was expressed in Escherichia coli strain Rosetta and purified without addition of detergent as described in [25].
Oligonucleotides (all 5'-3' Structures)
Oligodeoxyribonucleotides d(GTGTGGAAAATCTCTAGCAGT) (U5B), and d(ACTGCTAGAGATTTTCCACAC) (U5A) for studies of the effect of inhibitors on the integrase catalytic activity were synthesized by the phosphoramidite method on an automated DNA synthesizer Applied Biosystems ABI 3400 according to standard protocol and using commercial reagents (Glen Research). Purification of oligonucleotides was performed by electrophoresis in 20% polyacrylamide gel (PAAG) under denaturing conditions in the presence of 7 M urea. 5'- [32P] - Phosphorylation of oligonucleotides (10 pmol of U5B) was performed using T4 polynucleotide kinase and 2 pmol of [γ-32P]-ATP (3000 Ci/mmol) for 60 min at 37°C in 20 µL of a buffer containing 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM DTT.
Inhibition of 3'-End Processing
Inhibition of 3'-end processing was performed as described in [25]. Briefly, a 32P-labeled duplex U5B/U5A (3 nM) was incubated with integrase (100 nM) in 20 µL of a buffer (20 mM HERES, pH 7.2, 7. 5 mM MgCl2, 1 mM DTT) in the presence of increasing concentrations of an inhibitor (0 − 15 µM) at 37ºC for 2 h. The reaction was stopped by adding 80 µL of a stop solution (7 mM EDTA, 0.3 M NaOAc, 10 mM Tris-HCl, pH 8.0, 0.125 mg/mL glycogen). Integrase was extracted with a mixture phenol-chloroform-isoamyl alcohol 25 : 24 : 1; the DNA duplex was precipitated with ethanol (250 µL) and analyzed by electrophoresis in 20% PAAG with 7M urea. The gel was analyzed on a multifunctional scanner GE Healthcare Typhoon FLA 9500. The reaction course was evaluated by appearance on the gel of a band corresponding to the mobility of the oligonucleotide U5B, shortened by two links (U5B-2). The effectiveness of the reaction was evaluated using the Quantity One™ 4.6.6. program. IC50 values were determined from three independent experiments as the inhibitor concentration required for 50% inhibition of the reaction using GraphPad prism 7.03 software.
Antiviral activity DB3P(n) and MB3 against HSV-1
Cell cultures. In this work, a continuous Vero cell line (African green monkey kidney) and human fibroblast (HF) cells were used. Vero cells were cultivated in MEM and HF cells, in DMEM supplemented with 10% embryonic calf serum media (ETS, BioLot, Russia), 2 mM L-glutamine (PanEco, Russia), and 50 µg/mL gentamycin (PanEco, Russia).
Viruses. Reference HSV-1 F strains and CMV AD169 were used. Their activities were evaluated on Vero (HSV-1) and HF (CMV) cell cultures using the modified plaque reduction assay.
Cytotoxicity of the tested compounds towards Vero cells sensitive to HSV-1 and HF cells sensitive to CMV were assessed by the MTT method. The percentage of viable vs the total number of cells in the population 72 h after addition of the tested compounds was calculated. The CC50 values were calculated using the Microsoft Excel program.
Antiviral activity of the tested compounds was studied using a standard plaque reduction assay.
Microbicidal assay (express prophylaxis). A medium supplemented with 2% serum (supporting medium) and the tested compounds at various concentrations was loaded on the cell monolayer and the mixture was incubated for 1 h at 37º С. The viruses were introduced the mixture was incubated for 1 h at 37º С. The cell monolayer was washed and the supporting medium was added.
Post-treatment assay (therapy). The viruses were introduced on the monolayer and the mixture was incubated for 1 h at 37º С. The cells were washed twice and the supporting medium containing the tested compounds at various concentrations was added.
Virucidal (virus-neutralization) assay. The viruses were incubated with the tested compounds at various concentrations for 1 h at 37º С. The incubation mixture was loaded on the cell monolayer and the mixture was incubated for 1 h at 37º С. The cell monolayer was washed twice and the supporting medium was added.
As a control, the infected cells untreated with the tested compounds were used. Antiviral activity was assessed by calculating the number of infected cells in the experiment vs control in 48 h (HSV-1) and 96 h (CMV) after infection. For the calculation of IC50, a concentration inhibiting virus plaque formation by 50% relative to the control, the dependence of the inhibition degree of viral activity vs the compound concentration was plotted. The IC50 values were calculated using a Microsoft Excel packet. The selectivity index (SI) of compounds was calculated as the ratio of CC50 to IC50).
Inhibition of the catalytic activity of eukaryotic topo I.
The human cell lines U251 were purchased from American Type Culture Collection; ATCC, Manassas, VA, USA. A normal human kidney epithelia lcell line NKE-hTERT cell line was kindly provided by K. Gurova (Roswell Park Comprehensive Cancer Center, USA). DMSO and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT-reagent) were purchased from Sigma Chemical Co., topoisomerase from Invitrogen (ThermoFisher, USA). The stock solutions of DB3P(n) and MB3 were made in DMSO.
Cell culture
All cell lines were cultured in DMEM (Dulbecco’s Modified Eagle Medium) supplemented with 10% fetal calf serum (BioWhittaker, Belgium), 2mM L-glutamine, 100U/ml penicillin, and 100 U/ml streptomycin at 370С, 5% СО2 in humidified atmosphere. Cells in logarithmic phase of growth were used in all experiments. The final concentration of DMSO was 0,5% in the culture medium. DMSO at this concentration didn’t affect the viability of the cells.
Cytotoxicity and penetration into cells
Various human cells were seeded in 96-well plates containing 190 µl of medium at 3000–4000 cells/well and allowed to attach overnight. After 24 h plates were incubated with varying concentration of the studied compounds during 72 h. The cell viability was determined by the MTT-assay. The light absorbance of converted dye in living cells was measured at 570 nm wavelength using a microplate spectrophotometer (Benchmark Plus, BioRad).
Penetration of the tested compounds into U251 human glioblastoma cells was evaluated using a fluorescent microscope (Zeiss, Germany) in the UV area at 40X magnification. Dimeric trisbenzimidazoles DB3P(n) were added to the cell culture at a final concentration of 20 µM. After one day the cells were washed with PBS and fixed with paraformaldehyde (4%).
Inhibition of catalytic activity of eukaryotic topoisomerase I in the relaxation reaction of supercoiled DNA.
Modulation of topo I activity in vitro was studied using the Topoisomerase I Drug Screening kit (TopoGen). 3,5 units of purified topoisomerase from calf thymus (Fermentas, Lithuania) and the studied compounds were incubated with 0.2 µg of supercoiled plasmid DNApHOT1 (TopoGen) in reaction buffer (10 mM Tris.HCl, pH 7.9: 1 mM EDTA, 0.15 M NaCl, 0.1% BSA, 0.1 mM spermidine, 5% glycerol). The mixture was incubated for 30 min at 37°C, the reaction was stopped by addition of SDS to the final concentration 1%, and the reaction mixture was treated by proteinase K at the final concentration 50 µg/ml for 30–60 min at 37°C. The reaction products were separated electrophoretically in 1% agarose gel with TAE buffer (2 M Tris_base, 0.05 M EDTA, 1.56 M acetic acid) at the maximal voltage 3–4 V/cm. The gel was then stained with 0.5 µg/ml ethidium bromide. The presence of DNA in the gel was visualized by UV fluorescence with wavelengths from 240 to 360 nm. In the absence of inhibitor, topo I relaxed scDNA with formation of a series of relaxed topoisomers. Topo I inhibition was revealed by the ability of the studied compounds to retard scDNA relaxation, that is via the decreased composition of migrating topoisomers and restoration of scDNA.