Strains, medium, condition
A transposon library was generated using M. smegmatis mc2155 as previously described [28, 29] and plated on 7H10 agar containing 20 mg/L kanamycin. Approximately, 1000 single colonies of variable sizes were randomly placed into 96 deep well plates containing 0.5 mL of Middlebrook 7H9 medium (BD Difco) containing kanamycin and grown at 37°C. After 5 days of growth, cultures from each well were spotted on the Middlebrook 7H10 agar (BD Difco) plates, and more than 6 mutants were found for colony morphology defects. E. coli strain DH5α pir 116 (kindly provided by Dr. Kaixia Mi) was used to identify the insertion site of the transposon mutant. E. coli strain Top10 (TransGen Biotech, China) was used to clone specific DNA fragments into pSMT3 plasmid (Table 1). When required, kanamycin (50 mg/L for E. coli and 20 mg/L for mycobacteria) and hygromycin (150mg/L for E. coli and 75 mg/L for mycobacteria) were added to the growth medium.
Transposon identification
To identify mutants with growth defects, genomic DNA was prepared from the selected transposon mutant. The genomic DNA was randomly digested with BamHI (Fermentas International Inc.) and then purified with a DNA extraction kit (Fermentas International Inc.). The purified DNA was ligated and transformed into DH5α pir116 competent cells. The plasmids from the kanamycin-selected positive colony were isolated and sequenced with following primers: TLP1 5’-GCTGACCGCTTCCTCGTGCTTTA-3’; TLP2 5’-GCAGCGCATCGCCTTCTATC-3’.
Construction of complemented strain of aceE-mut
For complementation of aceE-mut strain, 2.79 kb full-length aceE gene (MSMEG_4323) from M. smegmatis was cloned into the mycobacterial shuttle vector pSMT3[30] using NEBuilding pfu kit (New England Biolabs, Ipswich, MA), and pSMT3-aceE was generated (Table 1). The plasmid pSMT3-aceE was subsequently transformed into aceE-mut strain to generate the complemented strain i.e. Comp (Table 1). The transformants were selected on 7H10 agar plates, supplemented with 20 mg/L kanamycin and 75 mg/L hygromycin, followed by incubation at 37°C for 3‒4 days. The positively grown colonies were picked and identified by PCR-sequencing methods using following primers:
aceE_S-FP1
|
CGGGCTGCAGGAATTCGATTTGACCACCGAGTTCG
|
aceE_S-RP1
|
GACGGTATCGATAAGCTTGATTCAGGCGCTGCCGGTG
|
Colony morphology observation
To compare the colony sizes for different mycobacterial strains, log phase cultures were 10× serially diluted (1:10), grown on 7H10 medium at 37°C and examined visually for any change. Photographs were taken after 3‒4 days of incubation using stereo microscope (Leica MZ APO).
Morphological observation by electron microscopy
Mycobacteria from log phase were harvested and washed with 0.1M phosphate buffer (PBS). Cells were subsequently fixed using 2.5% glutaraldehyde. Post fixation was carried out in 1% osmic acid. Following several rinses with ddH2O, samples were dehydrated in a series of different concentrations of ethanol and 100% acetone. For transition solvent, resin: acetone (2:1) were used overnight. Epoxy resin-812 was used for 1 h for embedding. 90 nm sections were cut and stained with uranyl acetate and Reynold’s lead citrate (Ted Pella, Inc). After drying, transmission electron microscopic (TEM) images of the sections were taken using TEM-1400plus. The cell wall thickness was measured for each strain as follows: 100 mycobacteria in the visual field were randomly selected, the largest distance between the outer membrane and the inner membrane of each cell was measured and the data were statistically analyzed using One Way ANOVA with Bonferroni correction. For scanning electron microscopy (SEM), ethanol dehydrated samples were dried in freeze-drier and coated with 10 nm gold film using ion sputter. Scanning electron microscopic images were taken using HITACHI SU8010.
Estimation of Pellicle and biofilm formation
For pellicle formation assay, mycobacteria were inoculated in 4~5 mL of Middlebrook 7H9 medium without Tween-80 and grown at 37°C without shaking. Biofilm formation was measured in M63-based liquid medium as previously described [31-34]. Biofilms of all three strains were grown in 96-well polystyrene plates or glass tubes containing M63-based liquid medium complemented with casein hydrolysate and glucose (without Tween-80), inoculated with 0.1% log phase culture, and incubated at 30°C for 5‒7 days under static conditions[33, 34]. The biofilm formation in each of the liquid cultures was qualitatively analyzed by photography and the images were processed using Adobe Photoshop CS5 software, and quantified with crystal violet staining, as previously described [31, 32].
Growth profile of strains
The growth characteristics of M. smegmatis mc2155, aceE-mut, Vector (aceE-mut:Vector) and Comp (aceE-mut:aceE) strains were studied in neutral (pH6.8) or acidified (pH5.0, the pH was adjusted with hydrochloric acid) 7H9 medium. The cultures were inoculated with an initial optical density at 600 nm (OD600) of 0.01 and incubated at 37°C with constant shaking at 200 rpm. OD600 was measured at specified time intervals and 10-fold serial dilutions were plated on 7H10 agar plates for colony forming unit (CFU) counts.
Stress assays
To carry out in vitro stress studies, logarithmic phase M. smegmatis cultures (OD600~0.8) were harvested whereas diluted cultures were subjected to different stresses. For oxidative stress, M. smegmatis cultures at OD600 (~0.4) were exposed to hydrogen peroxide (H2O2, 0.1% or 1%) and CFU was determined after 24 h. For other stresses, M. smegmatis cultures, prepared as above, were adjusted to OD600=0.4 and NaNO2 (0.5% or 5%) or Sodium dodecyl sulfonate (SDS, 0.1% or 1%) was added. CFU was determined after 1 h with SDS and after 24 h with NaNO2.
Antimicrobial susceptibility testing
Minimal Inhibitory Concentration (MIC) determination was performed by using the alamar blue microtiter assay as recommended in CLSI guidelines [7]. The antibiotics tested in the study include isoniazid (INH), rifampicin (RFP), ethambutol (EMB), ofloxacin (OFX), levofloxacin (LFX), moxifloxacin (MFX), amikacin (AMK) and capreomycin (CPM). The bacterial suspensions of 1.0×106 CFU/well were seeded in 96-well plates in presence of antibiotics at concentrations 0.5, 1, 2, 4, 8, 16, 32, 64, 128, and 256 μg/mL and incubated at 37°C for 2 days. Alamar blue dye was added in each well and the plates were re-incubated at 37°C for 24 h. The color change from blue to pink indicated bacterial growth. The MIC was defined as the minimal concentration of the drug showed no color changes, which was the lowest concentration of drug that can inhibit the visible growth of the bacterium.
Mycolic acid analysis using HPLC-Sherlock mycobacterium identification system
Bacterial cultures were collected for isolation of mycolic acids in the cell walls by extraction, saponification, and derivation according to instructions for the Sherlock Mycobacteria Identification System (SMIS; MIDI, Inc.). Mycolic acid composition of each sample was analyzed by SMIS using HPLC.
Analysis of the composition of mycolic acids and lipids using LC-MS
Total lipids were extracted from the samples using an improved Bligh/Dyer extraction method (double extraction) and appropriate internal standards were added as previously described [17]. Analysis of mycolic acids and lipids was carried out using normal-phase LC-MS as previously described, with minor modification [35, 36]. The experiments were conducted with the help of Lipidall Technologies Company Limited (Changzhou, Jiangsu, China). Briefly, the Exion uplc-qtrap 6500 PLUS (Sciex) liquid-mass spectrometer was used for all of the experiments whereas the electric spray ionization (ESI) mode was used for all the analyses. The following conditions were used: curtain gas = 20, ion spray voltage =5500 V, temperature = 400 °C, ion source gas 1 = 35, and ion source gas 2 = 35. Phenomenex Luna 3-micron silica column (inner diameter 150x2.0mm) was used to separate different kinds of polar lipids using mobile phase A (chloroform: methanol: ammonia 89.5:10:0.5) and B (chloroform: methanol: ammonia: water 55:39:0.5:5.5) using NP-HPLC. The gradient of mobile phase A was maintained for 5 min from 95%, then linearly decreased to 60% within 7 min and maintained for 4 min, and then it was further reduced to 30% and maintained for 15 min. Finally, the initial gradient was maintained for 5 min. Multiple reactions monitoring (MRM) conversion was established for the comparative analysis of various polar lipids and the signal intensity of each MRM value was normalized to an internal standard for quantitative comparisons.
Macrophage infections
Bacteria at log phase was collected and washed with RPMI1640 before infection. Infection of THP-1 cell (ATCC TIB-202) was performed at a multiplicity of infection (MOI) of 10:1 and 1:1 (bacteria: macrophage), using the following conversion: an OD of 1 = 3×108 CFU/mL. After 2hr of incubation at 37°C, the extracellular mycobacteria were removed by three washings with 1×PBS and RPMI1640 complete medium containing 100 μg/ml gentamycin was added to inhibit growth of exogenous mycobacteria in infected wells. At 0 h, 2 h and 24 h, infected macrophages were harvested and lysed with 0.1%Tween-80. Then the lysates were serially diluted with 0.05% Tween-80, and plated on 7H10 agar plates with or without the antibiotic. The plates were incubated at 37°C until colonies could be counted.
Statistical analysis
All statistical analyses were performed using SPSS statistics 21. Statistical differences were determined by One Way ANOVA with Bonferroni correction when comparing more than two groups. For mycolic acid and lipid quantification experiments, One Way ANOVA with Tukey’s HSD correction was used. Student t test was used to compare the statistical differences between two groups. Only P values < 0.05 were considered as statistically significant.