2.1. Cells and virus
Vero E6 cells were provided by the Military Veterinary Research Institute (Changchun, China). The classic PEDV CV777 strain was purchased from the Collection of Chinese Bacteria and Virus Species (Beijing, China).
2.2. Isolation, purification, and characterization of exosomes
First, Vero E6 cells were cultured in DMEM (HyClone, USA) containing 10% fetal bovine serum until the cells grew to 90%. The culture medium was then discarded, and cells washed with phosphate-buffered saline (PBS). The experimental group was infected with 1 multiplicity of infection (MOI) of PEDV CV777 standard vaccine strain, and the mock infection group was inoculated with the same volume of DMEM. The samples were then incubated for 1 h at 37°C, supplemented with serum-free DMEM, and allowed to culture for a further 48 h. The supernatant was collected and stored at − 80°C. Secondly, we used exosome isolation kits (Umibio Co., Ltd. Shanghai, China) for exosome isolation. Briefly, the sample was centrifuged for 10 min at 4°C to remove cell debris, and the supernatant was filtered through a 0.22 µm filter. Then, a 30 kDa ultrafiltration tube was used to concentrate the exosomes. In accordance with the manufacturer’s instructions, a half volume of exosome precipitation agent was added to the sample and incubated overnight at 4°C. The sample was centrifuged at 4 ℃ and 10,000g for 1 h. The sediment at the bottom of the centrifuge tube was resuspended in PBS and transferred to the exosome purification filter (EPF) column and centrifuged at 4000g for 10 min at 4 ℃ to collect the liquid at the bottom of the tube. As mentioned earlier, the product was further purified by ultracentrifugation[15]. Finally, the exosomes were characterized by transmission electron microscopy (TEM) and Western blotting.
2.3. RNA extraction and transcriptome sequencing
In accordance with the manufacturer’s instructions, total RNA was extracted from exosomes obtained from the different treatment groups using a Simply P Total RNA Extraction Kit (BioFlux, China). The quality of total RNA was determined using the Agilent Small RNA Kit on an Agilent 2100 Bioanalyzer. According to the small RNA protocol, small RNAs were subjected to library construction using the Ion Total RNA-Seq Kit v2 (Life Technologies Corp.). Bioanalysis was done on an Agilent 2100, Eukaryote Total RNA Pico Series II, and RNA-Seq analysis on an Illumina Hi Seq 2500 Sequencing System.
2.4. Quantitative real-time RT-PCR (qPCR) analysis
Total RNA was extracted and purified using the BioFlux RNA Extraction Kit (BioFlux Company, Tokyo, Japan). For exosomal microRNA (miR-103a, let-7d, miR-411, miR-345, miR-328-3P) expression analysis, 0.5 mg of total RNA was first reverse-transcribed with the PrimeScript® 1st Strand cDNA Synthesis Kit (BioFlux Company, Tokyo, Japan) according to the standard protocol. qPCR was performed using SYBR®Premix Ex TaqTM II (TaKaRa, Dalian, China) based on the manufacturer’s instructions. The primer sequences are shown in Table 1. For mRNA expression analysis, complementary DNA (cDNA) was synthesized using the PrimeScript® 1st Strand cDNA Synthesis Kit (BioFlux Company, Tokyo, Japan) according to the manufacturer’s protocol. Briefly, 2.0 µL of the cDNA template was added to a total volume of 20.0 µL containing 10.0 µL of SYBR®Premix Ex TaqTM II (TaKaRa, Dalian, China), 0.4 µL of Rox 6.0 µL of ddH2O, and 0.8 µL of the forward and reversed primers. The thermal cycling conditions were as follows: (1) pre-denaturation (30 s at 95 ℃); (2) amplification and quantification (40 cycles of 30 s at 94 ℃, 30 s at 60 ℃). The relative expression was given as the ratio of expression of the target gene to the housekeeping gene using the formula 2−△△t. Relative expression was normalized and given as a ratio to the expression in the control group.
Table 1
Gene primer sequence list
Gene name
|
microRNA sequence 5′–3′
|
RT-primer sequence 5′–3′
|
Forward primer sequence of
qPCR 5′–3′
|
Reverse primer sequence of
qPCR 5′–3′
|
miR-103a
|
AGCAGCAUUGUACAGGGCUAUGA
|
GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACTCATAG
|
GCGAGCAGCATTGTACAGGG
|
AGTGCAGGGTCCGAGGTATT
|
let-7d
|
AGAGGUAGUAGGUUGCAUAGUU
|
GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACAACTAT
|
GCGCGAGAGGTAGTAGGTTGC
|
AGTGCAGGGTCCGAGGTATT
|
miR-411
|
AAGGGCTTCCTCTCTGCAGGA
|
GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACTCCTGC
|
CGCGAAGGGCTTCCTCTCT
|
AGTGCAGGGTCCGAGGTATT
|
miR-345
|
AGTGCTCCAGGGCTGCGCCTGA
|
GTCGTATCCAGTGCAGGGTCCGAG
GTATTCGCACTGGATACGACTCAGGC
|
CGAGTGCTCCAGGGCTGC
|
AGTGCAGGGTCCGAGGTATT
|
miR-328-3P
|
CTGGCCCTCTCTGCCCTTCCG
|
GTCGTATCCAGTGCAGGGTCCGAGGTA
TTCGCACTGGATACGACCGGAAG
|
CGCTGGCCCTCTCTGCC
|
AGTGCAGGGTCCGAGGTATT
|
ZO-3
|
|
|
CTGTGGTTGTGTCTGACGTGGTAC
|
GGCTATCTTGACGCAGGTCTTGAG
|
ZO-3-WT
|
|
|
ATCTCTGGAGGCCGAGACCGGCC
CGGTGGATCCATGGTTGTATCTGA
CGTGGTACCTGGAGGGCC
|
CCGTTCACCATGACGATGTGGTCG
CCTGTCTGTAGCCTGCCCTCCGCC
GGCCCTCCAGGTACCAC
|
ZO-3-MUT
|
|
|
ATCTCTGGAGGCCGAGACCGGCCC
GGTGGATCCATGGTTGTATCTGACG
TGGTACCTCCTGCCCG
|
CCGTTCACCATGACGATGTGGTCG
CCTGTCTGTAGCCTCGGGAGCGGCC
GGGCAGGAGGTACCAC
|
PC (ocu-miR-328-3p)
|
|
|
CCGGAAGGGCAGAGAGGGCCAGAC
CGGTCGGAAGGGCAGAGAGGGCCAGC
|
TCGAGCTGGCCCTCTCTGCCCTTCC
GACCGGTCTGGCCCTCTCTGCCCT
TCCGGAGCT
|
Over-ZO-3
|
|
|
CGCCCCCTCACCCTGGT
|
TGCTGTGAAAATACTCTGTTTATTAAA
GACCAGGTGG
|
All the above primers were synthesized by Shanghai Shengong Biotechnology Co., Ltd. |
2.5. Western blot analysis
Exosomal protein and PEDV nucleocapsid protein (PEDV-N) were detected by Western blotting. Briefly, the protein concentration of exosomes and PEDV-N was detected using the BCA Protein Detection Kit (Biouniquer Technology CO., LTD, Nanjing, China), and 50 µg of protein lysate from each sample was used for further analyses. After SDS-PAGE electrophoresis, the protein was electro-transferred to a polyvinylidene difluoride (PVDF) membrane. Next, 5% skimmed milk powder was used to block nonspecific antibody binding to the membrane for 1 h. Rabbit anti-CD63/TSG101 monoclonal antibody (Abcam, UK), rabbit anti-ZO3 monoclonal antibody (ImmunoWay, China), mouse anti-PEDV-N monoclonal antibody (Medgene Labs, UK), and β-actin primary antibodies (ImmunoWay, China) were added (overnight at 4 ℃). Samples were washed with TBST 3 times, and HRP-labeled Goat Anti-Rabbit IgG and Goat Anti-Mouse IgG (Proteintech, Chicago, USA) were added. Samples were then incubated at room temperature for 1 h, and NC membranes were washed with TBST 3 times. Finally, the blots were visualized with ECL kits (Beyotime, Shanghai, China). The signal intensity was quantified using grayscale analysis software (Image Tool 3.00).
2.6. Virus titer detection and cytopathic observation
The sample to be detected was serially diluted 10-fold. A solution of each concentration was added to each column at 100 µL per well, which was repeated 8 times for each concentration, followed by the addition of 100 µL of 2% DMEM. The control was established in a virus-free medium and cultured at 37°C in 5% CO2. The virus TCID50 was calculated using the Reed–Muench formula. The exosomes of the PEDV CV777-infected Vero cells were extracted, and the PEDV-infected Vero cells with or without exosomes were incubated in a 1.3% methylcellulose medium for 48 h. Then, 4% formaldehyde was added overnight at room temperature and cells were stained with crystal violet staining solution. The cytopathic effect (CPE) results were observed through a Leica DMi8 (Leica, Germany) inverted fluorescence microscope.
2.7. Plasmid construction
The GP-miRGLO vector was used for the construction of ZO-3-WT/ZO-3-MUT/PC. First, we used the primers listed in Table 1 to clone the target gene into the cloning site of the GP-miRGLO vector. After the plasmid was transformed into competent cells, the plasmid was then extracted using the Plasmid Large-Scale Extraction Kit (Sigma-Aldrich, China) and used for subsequent experiments. The primers in Table 1 were used to amplify the complete sequence of the ZO-3 gene from Vero E6 cells for cloning into the pLVX-IRES-ZsGreen1 (Clontech, USA) vector. To ensure the fidelity of the gene sequence, we followed the appropriate operating steps for the production and packaging of lentiviral vectors [16]. When Vero E6 cells grew to 80% confluence, the cells were transfected with the lentiviral vector. After 48 h, the cells and supernatant were harvested for the next experiment.
2.8. Transfection of cells
Lipofectamine 2000 (Invitrogen) was used for transfection when the cells had grown to 80% confluence in a 24-well plate. The miRNA, inhibitor (50 nM), and ZO-3-WT/ZO-3-MUT/PC (2 µg) were co-transfected for 24 h. The dual-luciferase experiment was then performed. miRNA mimics and inhibitors (50 nM) were transfected for 24 h, and 1 MOI of PEDV was added for detection of PEDV infection. The siRNA (100) in Table 1 was transfected into the cells produced by the lentiviral vector for 24 hours and then infected with PEDV of 1 MOI, after which the subsequent experiments proceeded.
2.9. Dual-luciferase reporter gene activity assay
The Dual-Luciferase Reporter Assay System Kit (Promega, USA) was used for detection of luciferase activity in accordance with the manufacturer’s protocol. The Vero E6 cells were seeded onto 24-well plates 1 day prior to transfection. The cells were transfected with 1.6 µg of the GP-miRGLO reporter construct containing ZO-3-WT/ZO-3-MUT/PC (the primer sequences are shown in Table 1), together with 10 µL miR-328-3p mimic/mock using Lipofectamine 2000 (Thermo Fisher Scientific, USA). The cells were washed and lysed with the passive lysis buffer from the Dual-Luciferase Reporter Assay System (Promega Corp, USA) 48 h after transfection. Luciferase activity was measured in each cell lysate using a Multifunctional Microplate Reader (Tecan, USA). Relative luciferase activity was first normalized with Renilla luciferase activity and then compared with that of the respective control.