1.1 Animals
Mdx mice (C57BL/10ScSn-DMDmdx/J) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Wild-type C57BL/6 mice were purchased from the Guangdong Medical Laboratory Animal Center (Guangzhou, China). Mice were raised in a specific pathogen-free animal facility following standard animal facility procedures. The animal protocols were approved by the Animal Care and Experimentation Committee of Sun Yat-Sen University.
1.2 Cell preparation and fluorescence-activated cell sorting (FACS) isolation
The method for isolating mouse ADSC has been described previously [20]. ADSC were isolated from C57BL/6 mice (4 weeks old). Briefly, adipose tissue from inguinal fat deposits of mice was carefully separated and digested with 0.1% collagenase I (Invitrogen, Carlsbad, CA, USA). The acquired cell suspension was collected and cultured in growth media containing Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (Gibco, Grand Island, NY, USA) and 10% fetal bovine serum (FBS) (Gibco).
FAP isolation was performed following the protocol of a previous study [15]. The bilateral hind limb muscles of mdx mice (8 weeks old) were separated and digested in media containing DMEM, 800 U/ml collagenase II (Gibco), 0.3 U/ml dispase (Gibco). The single-cell samples were collected and incubated with the following primary antibodies (eBioscience, Grand Island, NY, USA) for 30 min at 4 °C: CD45, CD31, CD11b, Sca1, and ITGA7. 7-Aminoactinomycin D (7-AAD, eBioscience) was used to identify live/dead cells. Sorting was performed on a MoFlo Astrios EQs (Beckman Coulter Inc., Fullerton, CA, USA). FAP acquired by FACS were seeded on the cell culture cluster with Matrigel (Corning) coated previously in growth media containing DMEM/F12 medium, 20%FBS, 2.5ng/ml bFGF (Invitrogen).
1.3 Adipogenic, osteogenic, and myogenic differentiation of ADSC
Adipogenic and osteogenic differentiation of ADSC was previously described [22]. Myogenic differentiation was performed as previously described [20]. Briefly, ADSC were cultured in the myogenic induction medium [DMEM containing 10% FBS, 0.5 μM BIO (Santa Cruz, Dallas, TX, USA), 20 μM forskolin (Santa Cruz), and 10 ng/ml fibroblast growth factor-basic (bFGF) (PeproTech, Rocky Hill, NJ, USA)] for 7 days and then replaced with myogenic maintenance medium (DMEM supplemented with 2% horse serum) for further induction.
1.4 Construction of IL4 expressing plasmids and infection of lentiviral vectors
Vehicle lentivirus (pLent-EF1a- Green fluorescent protein (GFP)-P2A-Puro) and IL4-overexpressing lentivirus (pLent-EF1a-GFP-P2A-Puro-CMV-IL4) were purchased from OBiO Technology (Shanghai, China). Lentiviruses were used to transfect ADSC with a multiplicity of infection (MOI) of 60 and 6 μg/mL polybrene (OBiO Technology) were used for the 12-h lentiviral transduction. After 72 h of transfection, transfected ADSC were screened with 2 μg/mL puromycin for 48 h. Different treatments classified cells into two groups: ADSC transduced with vehicle lentivirus (VEH-ADSC), and ADSC transduced with IL4-overexpressing lentivirus (IL4-ADSC).
1.5 Co-culture of ADSC-derived myoblasts and FAP
Transwell (Corning, Midland, MI, USA) with a 0.4 µm pore polyester membrane insert was used for co-culture. IL4/VEH-ADSC were digested into single cells after inducing myogenic differentiation for 14 days, as previously described. Same number of IL4/VEH-ADSC-derived myoblasts and FAP were seeded in the chambers of the transwell in myogenic maintenance medium and a medium consisting of DMEM, 10%FBS and 1ug/ml insulin. After 14 days of co-culturing, the IL4/VEH-ADSC-derived myoblasts (IL4-ADSC Co-cult and VEH-ADSC Co-cult) were used for further analysis to study the effect of FAP on the myogenesis of ADSC-derived myoblasts. After 5 days of co-culturing, FAP co-cultured with ADSC-derived myoblasts (FAP (IL4-ADSC Co-cult) and FAP (VEH-ADSC Co-cult)) were used for further analysis to determine the effects of ADSC-derived myoblasts on the differentiation ability of FAP. Transwell chambers were coated with 0.1% gelatin. The medium was changed every two days.
1.6 Enzyme-linked immunosorbent assay (ELISA)
The IL4 level in the cellular supernatant was analyzed by ELISA. Generally, the ADSC were digested into single cells. 1*10^6 these cells were planted in a 35 mm cell culture plate (Corning), and a 2 ml culture medium was added to each plate. The cellular supernatant was collected after 24 h and analyzed using a Mouse IL4 Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions.
1.7 Cell counting kit 8 (CCK8) assays
Cell Counting Kit 8 (Abcam) was used to access the cell proliferation of IL4/VEH-ADSC. Generally, 10000 cells per well were plated in a culture microplate. After 24, 48 and 72 hours of culturing, add 10 µl/well (96 well plate) CCK8 Solution to each well. Protect from the light and incubate for 4 hours at 37℃. Measure the absorbance at OD = 450 nm.
1.8 Transplantation of ADSC
Male mdx mice (8 weeks old) were used in this study. VEH-ADSC and IL4-ADSC were induced to myogenic differentiation for 14 days and then digested into single cells in PBS for transplantation. These cells (2 × 106 cells in 200 μl PBS for each mouse) were administered systemically by injection into the tail vein of mdx mice (mdx+VEH-ADSC, mdx+IL4-ADSC, respectively), and the control mdx mice were injected with the same volume of PBS (mdx+PBS). In contrast, wild-type C57 mice of the same age and gender were used as healthy controls. After transplantation for 16 weeks, the four groups of mice were used to assess motor ability and then sacrificed to take and store muscle of tibialis anterior (TA) for further analyses. And there were five mice in each group.
1.9 Protein extraction and Western blotting
Whole-cell lysates were extracted using RIPA buffer (Thermo Scientific, Waltham, MA, USA) supplemented with Protease and Phosphatase Inhibitor Cocktail Kit (Thermo Scientific). Protein concentration was assessed using a BCA Protein Assay Kit (Thermo Scientific). Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (8% or 10 %) separated the soluble proteins. And then the proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA), blocked and then incubated at 4°C overnight with the primary antibodies: Myod1 (Santa Cruz), Myf5 (Abcam, Cambridge, MA, USA), Myogenin (Abcam), MyHC (DSHB, Iowa City, IA, USA), STAT6 (CST, Danvers, MA, USA), pSTAT6 (CST), AKT (CST), pAKT (CST), ERK1/2 (CST), pERK1/2 (CST), β-Tubulin (CST), GAPDH (CST), αSMA (Sigma, St. Louis, MO, USA), Collagen III (Abcam), Collagen I (Abcam), Perilipin-1 (CST), Acetyl-CoA Carboxylase 1 (ACC1, CST), PPARγ (CST), INOS(Abcam) and CD206 (Abcam) followed by incubation with secondary antibodies for 1 h at room temperature. Proteins were visualized using an enhanced chemiluminescence detection system (Thermo Fisher Scientific). Quantitative analysis of protein expression was performed using Image J software (National Institutes of Health, Bethesda, MD, USA).
1.10 Immunocytofluorescence and Immunohistofluorescence
The cultured cells were washed with PBS and fixed, permeabilized with 0.3% Triton X-100 (Sigma), blocked with 1% bovine serum albumin (BSA, Sigma), and incubated with the following primary antibodies overnight at 4 °C: Pax7 (Abcam), Myod1 (Abcam), Myf5 (Abcam), Desmin (Abcam), Dystrophin (Abcam), Myogenin (Abcam), MyHC (DSHB), and PDGFRα (CST), followed by incubation with secondary antibodies for 1 h at room temperature. The fusion index was determined as the ratio of the number of nuclei (at least two) incorporated into myotubes determined by immunodetection of MyHC to the total number. Tissue samples were cut into serial 8-μm frozen sections. Tissue sections were fixed with cold acetone, permeabilized and blocked as previously described, and then incubated with primary antibodies against Dystrophin (Abcam), GFP (Abcam), CD206(Abcam), and INOS(Abcam) overnight at 4 °C, followed by incubation with secondary antibodies for 1 h at room temperature. FluoroshieldTM with DAPI (Sigma) was used to stain the nuclei. Immunoreactivity was visualized and imaged using a NIKANG fluorescence microscope (Olympus, Tokyo, Japan).
1.11 Quantitative polymerase chain reaction (qPCR)
Total RNA was extracted from cells using RNAiso (Takara Bio Inc., Otsu, Japan) and cDNA was prepared using PrimeScript RT Master Mix (Takara Bio Inc.). qPCR was performed using Tli RNaseH Plus SYBR Premix Ex Taq (Takara Bio Inc.) and the following forward and reverse primers: IL4, 5’-AAACGTCCTCACAGCAACGA-3′ and 5′ - GCATCGAAAAGCCCGAAAGA -3′; IL-6, 5′- CCTACCCCAATTTCCAATGCTC -3′ and 5′- GGTCTTGGTCCTTAGCCACTC -3′; IGF1, 5′- TGGCGCTCTGCTTGCTCACCTT -3′ and 5′- TAAAAGCCCCTCGGTCCACACACG -3′; Wnt1, 5′- CCCCACCTCTTCGGCAAGAT -3′ and 5′- ATGGAGCCTTCGGAGCAGGA -3′; Wnt3a, 5′- AAGTGGGGCGGCTGTAGTGA -3′ and 5′- TTCATGGCAGAGCGGGCATC -3′; Wnt5a, 5′- CCACTTGTATCAGGACCAC -3′ and 5′- TGTGCTGCAGTTCCATCTC -3′;and GAPDH, 5′- GCACCGTCAAGGCTGAGAAC -3′ and 5′- TGGTGAAGACGCCAGTGGA -3′. GAPDH was used as an internal control.
1.12 Morphological studies
Collagen deposition was detected by Masson’s trichrome staining (Solarbio, Beijing, China) following the manufacturer’s instructions. Images were analyzed with Image J to quantify the ratio of the fibrotic area to the total area. The average of five random fields of each section was used for analysis, and three random sections of each mouse were used. Oil Red O stain kit (for cultured cells) (Solarbio) was performed according to the manufacturer’s instructions. Images were analyzed with Image J to quantify the area of Oil Red O staining. Five random detection fields were used, and three independent experiments were conducted.
1.13 Motor ability assessment
Two distinctive hanging tests were used to assess the motor abilities of the mice [23]. Generally, for hanging tests with two forelimbs, a metal cloth hanger was set tightly to a shelter at a distance of 37 cm above the ground. Handle the mouse and make it grasp the wire with two forelimbs only and start the timer once the mouse is released. For the hanging tests with four limbs, the lid of a big cage for rats was set tightly to a shelter at a distance of 25 cm above the ground. The mouse was placed on the grid with its four paws grasping it and start the timer once the mouse is released. The hanging time was recorded when the mouse fell. A fixed hanging limit was used for 600 s. The two hanging tests were repeated three times for each mouse, and the longest hanging time was used for the final analysis.
1.14 Statics analysis
Data were analyzed using SPSS (v.20.0; IBM Corp., Armonk, NY, USA) and GraphPad (v.8.0; GraphPad. Software, La Jolla, CA, USA). Data with a normal distribution are presented as mean ± standard deviation. Student’s t-test and analysis of variance were used for comparisons between the two groups. The Bonferroni test was used for comparisons between multiple groups.