CAMK2D: A Novel Molecular Target for BAP1-Deficient Malignant Mesothelioma

doi:10.21203/rs.3.rs-2323473/v1

Download PDF

Article

CAMK2D: A Novel Molecular Target for BAP1-Deficient Malignant Mesothelioma

https://doi.org/10.21203/rs.3.rs-2323473/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 21 Jul, 2023

Read the published version in Cell Death Discovery →

You are reading this latest preprint version

Malignant mesothelioma (MM) is a rare but aggressive malignancy. Although the molecular genetics of MM are known, including BRCA1-associated protein-1 (BAP1) gene alterations, the prognosis of MM patients remains poor. Here we generated BAP1 knockout (BAP1-KO) human mesothelial cell clones to develop molecular-targeted therapeutics based on genetic alterations in MM. cDNA microarray and quantitative RT-PCR (qRT-PCR) analyses revealed high expression of a calcium/calmodulin-dependent protein kinase type II subunit delta (CAMK2D) gene in the BAP1-KO cells. CAMK2D was highly expressed in 70% of the human MM tissues (56/80) and correlated with the loss of BAP1 expression, making it a potential diagnostic and therapeutic target for BAP1-deficient MM. We screened an anticancer drugs library using BAP1-KO cells and successfully identified a CaMKII inhibitor, KN-93, which displayed a more potent and selective antiproliferative effect against BAP1-deficient cells than cisplatin or pemetrexed. KN-93 significantly suppressed the tumor growth in mice xenografted with BAP1-deficient MM cells. This study is the first to provide a potential molecular-targeted therapeutic approach for BAP1-deficient MM.

Biological sciences/Cancer/Mesothelioma

Biological sciences/Drug discovery/Drug screening/Phenotypic screening

CRISPR/Cas9

BAP1

CAMK2D

KN-93

mesothelioma

Malignant mesothelioma (MM) is a neoplasm caused by exposure to asbestos, erionite, and therapeutic ionizing radiation to the chest (1–4). It causes approximately 43,000 deaths worldwide each year (5, 6). Many MM cases are resistant to standard chemotherapy and radiation, even after multidisciplinary treatment, including surgical resection. The median survival time after diagnosis in patients with MM is only 8 to 12 months. It is an incurable disease with a poor prognosis and outcome (7, 8). Recent molecular biological studies have revealed frequent genetic alterations in three tumor suppressor genes, neurofibromatosis 2 (NF2), cyclin-dependent kinase inhibitor 2A (CDKN2A, p16), and BAP1 in MMs (3, 4, 9, 10). BAP1 is also causally linked to a BAP1 tumor predisposition syndrome, characterized by increased susceptibility to MM, uveal and cutaneous melanomas, benign melanocytic tumors, and several other cancers (4, 11–14).

Recently, we found high expression of fibroblast growth factor receptor 2 (FGFR2) and CD24 in NF2-knockout (KO) mesothelial cell lines (15) and in NF2/p16-double knockout (DKO) cell lines, respectively (16), making them potential diagnostic and therapeutic targets for MM. In this study, we established BAP1 knockout (BAP1-KO) human mesothelial cell clones to develop molecular-targeted therapeutics based on frequent genetic alterations. cDNA microarray and quantitative PCR analyses revealed high expression of a calcium/calmodulin-dependent protein kinase type II subunit delta (CAMK2D) gene in the BAP1-KO cells. Immunohistochemical (IHC) analyses revealed that the loss of BAP1 expression is closely associated with CAMK2D-positive expression in human MM tissue samples. Ca²⁺ homeostasis is regulated by Ca²⁺/Calmodulin-dependent protein kinase II (CaMKII) in the nerve cells, which is essential not only for the plasticity of the synaptic transmission but also for tumor initiation, angiogenesis, progression, and metastasis (17). Among the four known CaMKII isozymes, CAMK2D (CaMKII delta) was highly expressed in crocidolite asbestos-exposed lung cell clones (18). It was also associated with cisplatin resistance in human epithelial ovarian cancer (19). Together with these reports (17–19), our findings suggest that CAMK2D can be a promising diagnostic and therapeutic target for BAP1-deficient MM. We also screened an anticancer drugs library using BAP1-KO cells and identified a CAMKII inhibitor, KN-93 as the most potent cell survival inhibitor. Here, we show that KN-93 exhibits a selective antiproliferative effect against BAP1-deficient MM cells, making it a potential candidate for molecular-targeted anticancer drugs.

BAP1 knockout enhances anchorage-independent cell growth in human mesothelial cells

We established two BAP1-knockout clones (BAP1-KO #1 and #2) using MeT-5A and HOMC-D4 human mesothelial cell lines with the CRISPR/Cas9 system targeting the exon 4 of the BAP1 gene (Fig. 1a) to develop the molecular-targeted therapeutics based on genetic alterations in MM. We also randomly selected single MeT-5A/BAP1 ^+/+and HOMC-D4/BAP1 ^+/+cell clones without the BAP1 gene knockout as the controls (hereafter called BAP1-WT cells, Ctrl). BAP1 expression was not detected in the BAP1-KO cells, while it was detectable in the parental and BAP1-WT cells (Fig. 1b). The MTT assay revealed no significant change in the growth rate in the BAP1-KO and BAP1-WT cells (Fig. S1a). However, in the semi-soft agar colony formation assay, the number of colonies was significantly increased in the BAP1-KO cells (Fig. S1b), suggesting that BAP1 loss might enhance anchorage-independent cell growth in human mesothelial cells.

Gene expression changes induce by BAP1-knockout

We performed cDNA microarray analyses to investigate the differences in the global gene expression profiles in BAP1-KO and BAP1-WT cells to understand the downstream signaling of BAP1. We successfully detected seven genes with more than 3-fold upregulated expression and 91 genes with less than 0.1-fold downregulated expression in the BAP1-KO human mesothelial cells (Fig. 1c; Table S1). Using RT-PCR, we analyzed eight genes to validate the gene expression changes seen in the microarray analysis. Agarose gel electrophoresis of the RT-PCR products showed higher mRNA expression of CAMK2D, MFAP4, NPTX1, and HMGA2, but it was lower for CD200, CD40, PRKCZ, and HOXA5 in the BAP1-KO cells than that in BAP1‐WT and parental cells (Fig. 1d). We performed qRT-PCR to precisely compare the expression levels in the cell clones. While the mRNA expression of CAMK2D, MFAP4, NPTX1, and HMGA2 was significantly increased in BAP1-KO cells, it was significantly decreased for CD200, CD40, PRKCZ, and HOXA5 (Fig. S2). To explore whether BAP1 is involved in these gene expression changes, we exogenously expressed BAP1 in the BAP1‐KO cells. Reconstitution of BAP1 into the BAP1-KO#1 cells abrogated the expression changes, including upregulation of the CAMK2D (Fig. 2a and Fig. S3), indicating that CAMK2D might function downstream of BAP1 signaling.

Loss of BAP1 expression is associated with histone H3 modification and upregulated CAMK2D expression

BAP1 is a nuclear deubiquitinase that interacts with transcription factors to regulate various cellular pathways, including cell cycle, differentiation, cell death, and gluconeogenesis (20). LaFave et al. demonstrated that a loss of BAP1 increases the trimethylated histone H3 lysine 27 (H3K27me3) and enhancer of zeste 2 polycomb repressive complex 2 subunits (EZH2) levels (21). Consistent with this report (21), we observed higher expression of H3K27me3 and EZH2 in the BAP1-KO cells than in the parental and BAP1-WT cells (Fig. 2b). Additionally, reconstitution of BAP1 into the BAP1-KO cells downregulated H3K27me3 and EZH2 (Fig. 2c), suggesting that BAP1 loss might upregulate H3K27me3 and EZH2 and activate their downstream signaling.

A recent study indicated that BAP1 is localized in the endoplasmic reticulum (ER) and bound to the type 3 inositol 1, 4, and 5-triphosphate receptor (IP3R3) (22). It stabilizes IP3R3 by deubiquitylation, releasing Ca²⁺ from the ER into the cytosol and the mitochondria. Among the seven upregulated genes in BAP1-KO cells, we focused on CAMK2D, whose protein product regulates Ca²⁺ homeostasis (17). Western blot analysis showed that CAMK2D expression was markedly higher in the BAP1-KO cells than in the parental and BAP1-WT cells (Fig. 2b). Additionally, reconstitution of BAP1 into BAP1-KO cells decreased CAMK2D expression (Fig. 2a and 2c), indicating that the loss of BAP1 might upregulate CAMK2D expression.

BAP1 loss is associated with positive CAMK2D expression in human MM tissues

To explore the relationship between BAP1 mutations and CAMK2D mRNA expression, we analyzed the publicly available data from the Cancer Genome Atlas (TCGA). We found that the CAMK2D expression level in MM patients with BAP1 somatic mutations is significantly higher than in patients with intact BAP1 (Fig. 3a). We next performed immunohistochemical (IHC) analyses of 80 human MM tissue samples to evaluate CAMK2D expression (Fig. 3b, and 3c, Table S2). Microscopic analysis indicated eight strong (3+), 34 moderate (2+), and 14 weak (1+) CAMK2D-positive signals among these 80 tissue samples (Table S2, Fig. 3d). Notably, the positivity rate for CAMK2D in BAP1-negative MM tissues was higher than that in BAP1-positive MM tissues: 56 of 59 BAP1-negative tissues vs. 7 of 21 BAP1-positive tissues (94% vs. 33%, Fig. 3d). These results indicated that the loss of BAP1 might be closely associated with CAMK2D-positive expression in human MM tissues.

CAMKII inhibitor KN-93 selectively suppresses the proliferation of BAP1-deficient mesothelioma cells

Since BAP1 mutation is a frequently occurring genetic alteration in MM, we explored potential molecular-targeted anticancer drugs for treating MM with BAP1 mutations. To this end, we screened the Screening Committee of Anticancer Drugs (SCADS) library, consisting of 363 chemical compounds (http://scads.jfcr.or.jp/kit/index.html), using the BAP1-KO MeT-5A and parental cells, and identified a CaMKII inhibitor, KN-93 as the most potent antiproliferative agent (Fig. 4a). The effect of 363 compounds on the cell survival is summarized in Table S3.

We examined the expression of CAMK2D and BAP1 in several MM cell lines to explore the efficacy of KN-93 on MM cells. Western blot analysis showed higher expression of CAMK2D in BAP1^–/–cell lines (Y-MESO-14, NCI-H2452, ACC-MESO-4, and Y-MESO-9 along with MeT-5A-BAP1-KO, HOMC-D4-BAP1-KO cells) than in the BAP1^+/+ cell lines (MeT-5A, parental HOMC-D4, and Y-MESO-12 cells) (Fig. 4b). BAP1 expression was detected only in the parental MeT-5A, parental HOMC-D4, and human mesothelioma Y-MESO12 cell lines (BAP1^+/+) (Fig. 4b). These results, in agreement with the IHC data, indicate that the loss of BAP1 is closely associated with CAMK2D-positive expression in human MM cell lines.

Subsequently, we assessed the antiproliferative efficacy of KN-93 on several mesothelial and MM cell lines with or without BAP1 expression. Interestingly, the average IC₅₀ value in BAP1^+/+ cells was 20 µM, whereas, in BAP1^–/– cells, it was 7.5 µM (Fig. 4c). This result suggests that KN-93 selectively suppresses the proliferation of BAP1^–/– cells with CAMK2D-positive expression. Combination chemotherapy with pemetrexed and cisplatin is relatively ineffective in increasing the survival time of MM patients. To overcome this, we compared the efficacy of KN-93 with that of cisplatin and pemetrexed using MM cell lines. We found that KN-93 showed a potent and selective antiproliferative effect against BAP1-deficient cells, while cisplatin or pemetrexed did not (Fig. 4d), indicating that KN-93 might be a promising candidate for molecular-targeted anticancer drugs.

KN-93 induces significant apoptosis in BAP1-deficient cells

We performed annexin V (AxV)/propidium iodide (PI) double staining-based FACS analysis to examine the effect of KN-93 on apoptosis. The number of AxV⁺/PI⁺ cells was significantly higher in the KN-93-treated BAP1^–/– (MeT-5A-BAP1-KO, HOMC-D4-BAP1-KO, and Y-MESO-9) cells than in the BAP1^+/+ (parental MeT-5A, parental HOMC-D4, and Y-MESO-12) cells (Fig. 5a). Similarly, the cleaved PARP level was markedly increased in the KN-93-treated BAP1^–/–cells (Fig. 5b), suggesting that KN-93 suppresses the proliferation of BAP1^–/–cells by promoting apoptosis. Consistently, the expression of CAMK2D, calmodulin (CaM), phospho-STAT3 (Y705), EZH2, H3K27Me3, and CDK2 was also decreased in the BAP1^–/–cells (Fig. 5b). Additionally, we generated BAP1/CAMK2D-double knockout (DKO) cells to further investigate the involvement of CAMK2D in the proliferations of the BAP1^–/–cells (Fig. S4a). We found that CAMK2D/BAP1-DKO reduced cell proliferation, strongly suggesting that CAMK2D might play a critical role in the tumor growth of BAP1-deficient MM cells (Fig. S4b).

We further measured the intracellular Ca²⁺ concentrations in the cell clones to study the effect of the CAMKII inhibitor KN-93 on Ca²⁺ homeostasis. The Ca²⁺ levels in BAP1-KO cells were significantly lower, while the levels in the BAP1/CAMK2D-DKO cells were similar to those in the parental cells (Fig. S4c). KN-93 treatment significantly increased the intracellular Ca²⁺ levels in the BAP1^–/–cells but not in the parental cells (Fig. S4d). Based on this result, we propose that KN-93 can promote apoptosis by increasing intracellular Ca²⁺ concentrations, most likely by inhibiting CAMK2D activity in the BAP1^–/–cells.

KN-93 suppresses the tumor growth of Y-MESO-9 in xenografted mice

We examined the in vivo effect of KN-93 on the tumor growth of BAP1^–/–cells (Y-MESO-9) using xenografted mice. KN-93 administration to mice significantly suppressed the tumor growth compared with vehicle control (Fig. 6a and 6b) without causing weight loss (Fig. 6c). These findings further support that targeting CAMK2D using KN-93 might be a viable therapeutic approach for BAP1-deficient MM.

KN-93 administration does not affect body weight and liver and renal functions

Finally, we evaluated the in vivo adverse effects of KN-93 on normal BALB/c strain mice. KN-93 administration did not cause significant changes in histological images of the heart, liver, and kidney (Fig. 5a) or body weight of mice (Fig. 5b) during the 14-day study period. Additionally, KN-93 administration did not significantly change blood chemical data (Table S6). Thus, our histochemical and blood chemical analyses did not reveal any obvious impairment of heart, liver, and renal functions in KN-93-treated mice. These results support our notion that KN-93 is a promising candidate for molecular-targeted anticancer drugs for treating BAP1-deficient MM.

BAP1, a major tumor suppressor gene, frequently undergoes genetic mutations in MM. We established BAP1-KO isogenic clones using immortalized human mesothelial cell lines to develop molecular-targeted therapeutics based on genetic alterations in MM. cDNA microarray analysis revealed that several genes were upregulated or downregulated in the BAP1-KO cells. Based on recent evidence showing the involvement of BAP1 in intracellular Ca²⁺ homeostasis (22), we focused on CAMK2D out of the seven upregulated genes. CAMK2D is one of four CaMKII isozymes, typically activated by binding to Ca²⁺/CaM via its regulatory domain and a multifunctional protein kinase that transmits calcium signaling (17, 23, 24). Several studies have shown high CaMKII expression in lung, breast, colon, and prostate cancers (25–28). Our molecular biology and IHC studies revealed high CAMK2D expression in the BAP1-negative MM tissues and cell lines, indicating that BAP1 loss might be linked with CAMK2D-positive expression. Thus, it is conceivable that BAP1 deficiency might participate in the tumorigenesis of mesothelial cells by mediating CAMK2D expression.

Since BAP1 regulates Ca²⁺ homeostasis (22, 29), we evaluated the intracellular Ca²⁺ levels and observed lower levels in BAP1-KO cells than those in parental cells. However, the Ca²⁺ levels in the CAMK2D /BAP1-DKO cells were restored to those similar to parental cells, suggesting that CAMK2D might regulate the intracellular Ca²⁺ levels in the BAP1-deficient cells. Moreover, BAP1-KO had a negligible effect on cell proliferation, whereas CAMK2D/BAP1-DKO reduced cell proliferation, suggesting that an emerging BAP1-CAMK2D axis might play a critical role in the tumor growth of BAP1-deficient MM cells. Our findings

support that CAMK2D is a potential diagnostic and therapeutic target for BAP1-deficient MM.

Upon screening an anticancer drugs library with BAP1-KO cells, we successfully identified a CaMKII inhibitor, KN-93 as the most potent cell survival inhibitor. KN-93 inhibits CaMKII activity by interfering with its binding to the Ca²⁺CaM complex (30, 31). After identifying KN-93, we investigated its inhibitory effect on several BAP1-positive and negative MM cell lines. We found that it selectively suppressed the proliferation of BAP1-negative cells rather than BAP1-positive cells. The median overall survival of MM patients after frontline chemotherapy with pemetrexed and cisplatin is approximately 12 months only (7, 32). Novel therapies are urgently needed to improve the prognosis of MM patients. Therefore, we further compared the efficacy of KN-93 with both pemetrexed and cisplatin in MM cells. KN-93 exhibited a robust and selective antiproliferative effect against BAP1-negative MM cells, while pemetrexed or cisplatin did not.

Then, we examined the effect of KN-93 on the apoptosis of MM cell lines and observed that it significantly increased DNA damage response molecules PARP, thus inducing apoptosis in BAP1-negative cells. Additionally, KN-93 markedly increased the intracellular Ca²⁺ levels in BAP1-negative cells but not in parental cells. Hence, we propose that KN-93 promotes apoptosis in BAP1-negative MM cells by increasing intracellular Ca²⁺ concentrations, most likely by inhibiting CAMK2D activity. Previously, a Ca²⁺-regulated decrease in apoptosis has been implicated in the cellular transformation in BAP1-related cancers (22).

Finally, we examined the effect of KN-93 on the tumor growth of BAP1-negative MM cells in vivo. We administered KN-93 to SCID mice xenografted with BAP1-deficient MM cells. We observed significantly lower tumor volume in these mice than in the vehicle control without any effect on the body weight. Moreover, KN-93 was shown to have no significant adverse impact on the histochemistry of heart, liver, and kidney or blood chemistry in normal BALB/c strain mice. All these results strongly suggest a lack of apparent toxic side effects. Based on these findings, we advocate that KN-93 is a promising molecular-targeted anticancer drug for treating BAP1-deficient MM.

In summary, our cDNA microarray and qRT-PCR analyses revealed high expression of CAMK2D in the BAP1-deficient mesothelial cells. Subsequent molecular biology and IHC studies revealed that the loss of BAP1 is closely associated with CAMK2D-positive expression in human MM tissues and cell lines. Although the molecular mechanism underlying CAMK2D upregulation via the loss of BAP1 remains unclear, BAP1 deficiency might be involved in tumorigenesis by mediating CAMK2D expression. Therefore, CAMK2D might be a novel diagnostic and therapeutic target for MM. Moreover, we identified a CAMKII inhibitor KN-93 as a potent and selective chemical antiproliferative agent, making it a potential molecular-targeted anticancer drug for treating BAP1-deficient MM. Previous studies reported a significantly high incidence (more than 60%) of MM with BAP1 alterations (4, 33, 34). Therefore, targeting the BAP1-CAMK2D (CAMKII delta) signaling axis is a promising therapeutic approach for most MM cases and BAP1 tumor predisposition syndrome.

Cell culture

Two immortalized normal human mesothelial cell lines, MeT-5A (pleural mesothelial) and HOMC-D4 (omental mesothelial; intermediate type), and five human mesothelioma cell lines, ACC-MESO-4, Y-MESO-12, Y-MESO-14, Y-MESO-9, and NCI-H2452, were kindly provided by Dr. Y. Sekido, Division of Molecular Oncology, Aichi Cancer Center Research Institute (Nagoya, Japan). The HOMC-D4 cell line was maintained as described previously (35). Y-MESO-9, Y-MESO-12, Y-MESO-14, Y-MESO-9, ACC-MESO-4, and NCI-H2452 cell lines were cultured in RPMI-1640 (Wako, Osaka, Japan) medium containing 10% fetal bovine serum (Sigma) and 1% penicillin-streptomycin (Wako) at 37°C in a 5% CO₂ humidified atmosphere.

Gene Knockout Using The Clustered Regularly Interspaced Short Palindromic Repeat (Crispr)/cas9 System

The CRISPR/Cas9 system was used to disrupt the BAP1 gene as described previously (36–37). pSpCas9(BB)-2A-GFP (PX458) was gifted by Feng Zhang (Addgene plasmid # 48138) (36). Briefly, a single guide RNA (sgRNA) sequence was selected using an optimized CRISPR design (http://crispr.mit.edu/). The sgRNA sequence used for BAP1 was 5′- TCAAATGGATCGAAGAGCGC − 3′ and the sequence used for CAMK2D was 5′- CACCGCAGCATATTCTTGTCCAGT − 3′, corresponding to exons 4 and 2, respectively. The plasmid expressing hCas9 and the sgRNA were prepared by ligating the oligonucleotides into the BbsI site of PX458 (BAP1/PX458 and CAMK2D/PX458).

The knockout clones were created by electroporating 1µg of BAP1/PX458 plasmid into 1 × 10⁶ cells using a 4D-Nucleofector™ system (Lonza Japan, Tokyo, Japan). Three days post-transfection, GFP-expressing cells were sorted using BD FACS ARIA III (BD Bioscience). A single clone was selected, expanded, and used for biological assays.

For BAP1 transduction, the BAP1/pcDNA3.1 vector was transfected into a BAP1-KO#1 clone with the 4D-Nucleofector System using the backbone pcDNA3.1 as a control vector. After transfection, the cells were incubated for 48 h, washed with phosphate-buffered saline (PBS), and lysed in the loading buffer. The lysates were used for Western blot analysis to check BAP1 expression.

Quantitative Rt-pcr (Qrt-pcr)

qRT-PCR analysis was performed using SYBR Green I detection as previously described (38) using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control. The primers used are provided in Table S4.

Cdna Microarray Analysis

cDNA microarray analysis was conducted based on the manufacturer's protocol (Agilent Technologies), as described previously (39). Briefly, we performed cDNA synthesis and cRNA labeling with cyanine 3 (Cy3) dye using the Agilent Low Input Quick Amp Labeling Kit (Agilent Technologies). The Cy3-labeled cRNA was purified, fragmented, and hybridized onto a Human Gene Expression 8x60K v2 Microarray Chip containing 62,969 Entrez Gene RNAs using a Gene Expression Hybridization kit (Agilent Technologies). The raw and normalized microarray data were submitted to the NCBI GEO database (accession number GSE168340; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE168340).

Cell Growth Assay

The cell growth rate was measured using MTT assays. Briefly, 1 × 10³ cells/well were seeded into 96-well plates and cultured for the indicated times. Subsequently, 10 µl of MTT solution (5 mg/ml; Sigma-Aldrich) was added to each well, and the cells were incubated for 4 h. Next, cell lysis buffer was added to the wells to dissolve the colored formazan crystals. The absorbance was measured at 595 nm using a SpectraMAX M5 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA).

Soft Agar Colony Formation Assay

A soft agar colony formation assay was performed as described previously (15, 16, 40). The number of colonies was counted using Colony Counter software (Keyence, Tokyo, Japan).

Western Blot Analysis

Western blot analysis was performed as described previously (40). The antibodies used are listed in Table S5. Immune complexes were detected using Immuno Star LD (Wako Pure Chemical Industries, Ltd., Osaka, Japan) along with a LAS-4000 image analyzer (GE Healthcare, Tokyo, Japan).

Annexin V Assay

Cells were seeded into 6-well culture plates (5 × 10⁵ cells/ well) and incubated with KN-93 (7.5 µM) for 48 h. After incubation with annexin V (Ax)-FITC and PI (10 µg/mL) at room temperature for 15 min, the fluorescence intensities were measured using fluorescence-activated cell sorting (FACS) using a FACS CantoII (BD, Franklin Lakes, NJ, USA).

Immunohistochemistry (Ihc)

IHC analysis was performed based on a previous method (41) using a human mesothelioma tissue array from US Biomax (MS801b and MS-1001a; Rockville, MD, USA). Sections were incubated with primary antibodies (BAP1 and CAMK2D antibodies, 2 µg/ml). We used either normal rabbit immunoglobulin G or no primary antibody as negative controls. Immunoreactivity was evaluated independently by two investigators (S.K. and H.M.). The staining intensity was scored as strong (+ 3), moderate (+ 2), weak (+ 1), or negative (0).

Screening Of Anticancer Drugs Library

The Screening Committee of Anticancer Drugs (SCADS) library, containing 363 compounds in four 96-well microplates (http://scads.jfcr.or.jp/kit/index.html) was kindly provided by Grant-in-Aid for Scientific Research on Innovative Areas, Scientific Support Programs for Cancer Research, from The Ministry of Education, Culture, Sports, Science and Technology, Japan. The compounds, consisting mostly of anticancer drugs and kinase inhibitors, were originally dissolved at a concentration of 10 mM in dimethyl sulfoxide (DMSO) solution. BAP1-KO and parental MeT-5A cells (3 ×10³ cells /well) were seeded into 96-well plates. Next day, cells were treated with a final concentration of 10 µM of each compound or diluent DMSO control (final 0.1% DMSO), and were further incubated for 72 h. MTT assays were performed according to the manufacturer’s instructions. The absorbance was measured at 595 nm using a spectrophotometer. The percentages of cell survival are calculated after normalizing to the mean optical densities in the untreated cells, which were arbitrarily defined as 100%. To identify the compounds with potent antiproliferative effects on BAP1-KO cells, we calculated the differences in the cell survival percentages between BAP1-KO and parental cells.

Xenograft Experiments

The animal experiments were approved by the ethics committee of Aichi Medical University and performed according to the established guidelines. Female Fox Chase SCID mice (CB17/Icr-Prkdcscid/IcrIcoCrl) (6–8 weeks old, each weighing 17–18 g) were purchased from CLEA Japan, Inc (Tokyo, Japan) and bred at the Institute of Animal Experiments in Aichi Medical University in specified pathogen-free animal facilities. Y-MESO-9 cells (1 × 10⁷ cells) were injected subcutaneously into these mice. When the inoculated tumor reached 100 mm³ (day 0), the mice were randomly divided into two groups (treatment and control groups). KN-93 (15 mg/kg body weight) was intraperitoneally administered on days 0, 4, 8, 13, and 16 to each mouse in the treatment group. The control group received PBS as vehicle control. The tumor volume was measured every three to four days and calculated using the modified ellipsoid formula (1/2 × length × width²).

In vivo effects of KN-93 on BALB/c mice

Eight-week-old female BALB/cCrSlc (n = 5, Japan, Inc, Tokyo, Japan) mice were obtained to evaluate the in vivo effects of KN-93. On days 0, 3, 5, 7, 10, and 12, KN-93 (15 mg/kg body weight) or PBS (vehicle control) was intraperitoneally administered to mice. Body weights were measured three times a week. At 14 days after the first administration, the control and treatment group mice were anesthetized using isoflurane, and approximately 0.5–1 ml of blood was collected in a heparin tube. The heparin-plasma samples were examined for blood chemistry by the Nagahama Life Science Laboratory (Oriental Yeast Co., Ltd., Shiga, Japan). The heart, liver, and kidney were carefully dissected for histochemical analyses from mice after the isolation of whole blood. Each organ was washed with PBS and fixed with phosphate-buffered formalin for 24 h. The tissues were trimmed, embedded in paraffin, sectionized into 5-µm thick sections, and stained with hematoxylin and eosin (H&E) (ab245880, Abcam, Cambridge, UK). The stained sections were observed by a microscope (BX41, Olympus, Tokyo, Japan).

Intracellular Ca Assay

Intracellular Ca²⁺ levels were measured using the CS22 Calcium kit-Fluo 4 (Dojindo, Japan) according to the manufacturer’s protocol. Shortly after removing the medium without damaging the cells, 100 µl of loading buffer was added to each well of 96-well plates. After incubating the cells at 37℃ for 1 h, the loading buffer was replaced with 100 µl warm recording medium (1X) preheated to 37℃. Fluorescence intensity changes were measured at an excitation wavelength of 480–500 nm and emission at 518 nm.

Statistical analysis

The results are expressed as the mean ± SE. Statistical significance between groups was determined using a one-way analysis of variance and Dunnett's comparison. Statistical analyses were performed using SPSS 23.0 software (SPSS Inc, Chicago, Illinois, USA).

MM, malignant mesothelioma; IHC, immunohistochemistry; CAMK2D, calcium/calmodulin-dependent protein kinase (CaM kinase) II delta; BAP1, BRCA1 associated protein‑1; CRISPR, clustered regularly interspaced short palindromic repeats; Cas9, CRISPR associated protein 9; qPCR, quantitative PCR; DKO, double knockout

Acknowledgments

We thank Dr. Y. Sekido, Division of Molecular Oncology, Aichi Cancer Center Research Institute, for providing the normal mesothelial cell line (MeT-5A and HOMC-D4). This work was partly supported by a Hirose International Scholarship foundation research grant, Grant-in-Aid for Scientific Research (KAKEN) from the Japan Society for the Promotion of Science (19K09292, 22K08985 to S.K. and 19K08668, 22K08294 to Y.H.) and the Research Grant from the Hori Science and Arts Foundation (HF03-2021-0012 to S.K.).

Competing interest

There are no conflicts of interest associated with this publication, and there has been no significant financial support for this work that could have influenced the outcome.

The manuscript has been read and approved by all the authors. There are no other individuals who satisfied the criteria for authorship but are not listed. All have approved the order of authors listed in the manuscript.

Carbone, M., Baris, Y.I., Bertino, P., Brass, B., Comertpay, S., Dogan, A. U., et al. Erionite exposure in North Dakota and Turkish villages with mesothelioma. Proc Natl Acad Sci U S A 108, 13618–13623 (2011).
Carbone, M. & Yang, H. Molecular pathways: targeting mechanisms of asbestos and erionite carcinogenesis in mesothelioma. Clin Cancer Res 18, 598–604 (2012).
Kukuyan, A. M., Sementino, E., Kadariya, Y., Menges. C. W., Cheung, M., Tan, Y., Cai, K. Q., Slifker, M. J., Peri, S., Klein-Szanto, A. J., Rauscher, F. J. 3rd. & Testa, J. R. Inactivation of Bap1 cooperates with losses of Nf2 and Cdkn2a to drive the development of pleural malignant mesothelioma in conditional mouse models. Cancer Res 79, 4113–4123 (2019).
Carbone, M., Adusumilli, P. S., Alexander, H. R., Baas, P., Bardelli, F., Bononi, A. et al. Mesothelioma: Scientific clues for prevention, diagnosis, and therapy. CA-Cancer J. Clin 69, 402–429 (2019).
Driscoll, T. Nelson, D. I., Steenland, K., Leigh, J., Concha-Barrientos, M., Fingerhut, M. & Prüss-Ustün, A. The global burden of disease due to occupational carcinogens. Am J Ind Med. 48, 419–431 (2005).
Chimed-Ochir, O., Arachi, D., Driscoll, T., Lin, R. T., Takala, J. & Takahashi, K. Burden of mesothelioma deaths by national income category: Current status and future implications. Int J Environ Res Public Health 17, 6900 (2020).
Vogelzang, N. J., Rusthoven, J. J., Symanowski, J., Denham, C., Kaukel, E., Ruffie, P., et al. Phase III study of pemetrexed in combination with cisplatin versus cisplatin alone in patients with malignant pleural mesothelioma. J. Clin. Oncol. 21, 2636–2644 (2003).
Gunatilake, S., Lodge, D., Neville, D., Jones, T., Fogg, C., Bassett, P., Begum, S., Kerley, S., Marshall, L., Glaysher, S., Elliott, S., Stores, R., Bishop, L. & Chauhan, A. Predicting survival in malignant pleural mesothelioma using routine clinical and laboratory characteristics. BMJ Open Respir Res 8, e000506 (2021).
Guo, G. et al. Whole-exome sequencing reveals frequent genetic alterations in BAP1, NF2, CDKN2A, and CUL1 in malignant pleural mesothelioma. Cancer Res. 75, 264–269 (2015).
Hakiri, S., Osada, H., Ishiguro, F., Murakami, H., Murakami-Tonami, Y., Yokoi, K. & Sekido, Y. Functional differences between wild-type and mutant-type BRCA1-associated protein 1 tumor suppressor against malignant mesothelioma cells. Cancer Sci 106, 990–999 (2015).
Cheung, M. & Testa, J. R. BAP1, a tumor suppressor gene, are driving malignant mesothelioma. Trend Lung Caner Res. 6,270–278 (2017)
Carbone, M., Kanodia, S., Chao, A., Miller, A., Wali, A., Weissman, D., et al. Consensus report of the 2015 Weinman International Conference on Mesothelioma. J Thorac Oncol 11, 1246–1262 (2016).
Piris, A., Mihm, M. C. Jr., Hoang, M. P. BAP1 and BRAFV600E expression in benign and malignant melanocytic proliferations. Hum Pathol 46, 239–245 (2015).
Haugh, A. M., Njauw, C. N., Bubley, J. A., Verzì, A. E., Zhang, B., Kudalkar, E., et al. Genotypic and phenotypic features of BAP1 cancer syndrome: a report of 8 new families and review of cases in the literature. JAMA Dermatol 153, 999–1006 (2017)
Wahiduzzaman, M., Karnan, S., Ota, A., Hanamura, I., Murakami, H., Inoko, A., et al. Establishment and characterization of CRISPR/Cas9-mediated NF2^–/–human mesothelial cell line: Molecular insight into fibroblast growth factor receptor 2 in malignant pleural mesothelioma. Cancer Sci. 110, 180–193. (2019).
Karnan, S., Ota, A., Murakami, H., Rahman, M. L., Hasan, M.N., Wahiduzzaman, M., et al. Identification of CD24 as a potential diagnostic and therapeutic target for malignant pleural mesothelioma. Cell Death Discov. 6, 127 (2020).
Cui, C., Merritt, R., Fu, L., & Pan, Z. Targeting calcium signaling in cancer therapy Acta Pharm. Sin. B. 7, 3–17 (2017).
Nymark, P., Lindholm, P. M., Korpela, M. V., Lahti, L., Ruosaari, S., Kaski, S., et al. Gene expression profiles in asbestos-exposed epithelial and mesothelial lung cell lines. BMC Genomics 8, 62 (2007).
Xu, X., Zheng, Z., Jia, L., Suo, S., Liu, B., Shao, T., et al. Overexpression of SMARCA2 or CAMK2D is associated with cisplatin resistance in human epithelial ovarian cancer. Oncol. Lett. 16(3), 3796–3804 (2018).
Carbone, M., Yang, H., Pass, H. I., Krausz, T., Testa J. R. & Gaudino, G. BAP1 and cancer. Nat. Rev. Cancer 13, 153–159 (2013).
LaFave, L. M., Béguelin, W., Koche, R., Teater, M., Spitzer, B., Chramiec A., et al. Loss of BAP1 Function Leads to EZH2-dependent Transformation. Nat. Med. 21, 1344–1349 (2015).
Bononi, A., Giorgi, C., Patergnani, S., Larson, D., Verbruggen, K., Tanji, M., et al. BAP1 regulates IP3R3-mediated Ca²⁺ flux to mitochondria suppressing cell transformation. Nature 546, 549–553 (2017).
Hegyi, B., Bers, D. M., & Bossuyt, J. CaMKII signaling in heart diseases: Emerging role in diabetic cardiomyopathy. J. Mol. Cell. Cardiol. 127, 246–259 (2019).
Wang, Y. Y., Zhao, R., & Zhe, H. The emerging role of CaMKII in cancer. Oncotarget. 6, 11725–11734. (2015)
Liu, C., Huang, Q., Ma, W., Qi, L., Wang, Y., Qu, T., et al. A combination of tumor and molecular markers predicts a poor prognosis in lung adenocarcinoma. Int. J. Clin. Exp. Pathol. 12, 1690–1701 (2019).
Britschgi, A., Bill, A., Brinkhaus, H., Rothwell, C., Clay, I., Duss, S., et al. Calcium-activated chloride channel ANO1 promotes breast cancer progression by activating EGFR and CAMK signaling. Proc. Natl. Acad. Sci. U. S. A. 110, E1026–E1034 (2013).
Yu, G., Cheng, C. J., Lin, S. C., Lee, Y. C., Frigo, D. E., Yu-Lee, L. Y., et al. Organelle-derived acetyl-CoA promotes prostate cancer cell survival, migration, and metastasis via activation of calmodulin kinase II. Cancer Res. 78, 2490–2502 (2018).
Chen, W., An, P., Quan, X. J., Zhang, J., Zhou, Z. Y., Zou, L. P., et al. Ca ²⁺/calmodulin-dependent protein kinase II regulates colon cancer proliferation and migration via ERK1/2 and p38 pathways. World J. Gastroenterol. 23, 6111–6118 (2017).
Ando, H., Kawaai, K., Bonneau, B. & Mikoshiba, K. Remodeling of Ca²⁺signaling in cancer: Regulation of inositol 1,4,5-trisphosphate receptors through oncogenes and tumor suppressors. Adv Biol Regul. 68, 64–76 (2018).
Nassal, D., Gratz, D., & Hund, T. J. Challenges and Opportunities for Therapeutic Targeting of Calmodulin Kinase II in Heart. Front. Pharmacol. 11, 35 (2020).
Villalobo, A., & Berchtold, M. W. The Role of Calmodulin in Tumor Cell Migration, Invasiveness, and Metastasis. Int. J. Mol. Sci. 21, 765 (2020).
Shapiro, I. M., Kolev, V. N., Vidal, C. M., Kadariya, Y., Ring, J. E., Wright, Q., et al. Merlin deficiency predicts FAK inhibitor sensitivity: a synthetic lethal relationship. Sci. Transl. Med. 6, 237ra68. (2014).
Nasu, M., Emi, M., Pastorino, S., Tanji, M., Powers, A., Luk, H., et al. High incidence of somatic BAP1 alterations in sporadic malignant mesothelioma. J. Thorac. Oncol. 10, 565–576 (2015).
Yoshikawa, Y., Emi, M., Hashimoto-Tamaoki, T., Ohmuraya, M., Sato, A., Tsujimura, T., et al. High-density array-CGH with targeted NGS unmask multiple noncontiguous minute deletions on chromosome 3p21 in mesothelioma. Proc. Natl. Acad. Sci. U S A. 113, 13432–13437 (2016).
Kakiuchi, T., Takahara, T., Kasugai, Y., Arita, K., Yoshida, N., Karube, K., et al. Modeling mesothelioma utilizing human mesothelial cells reveals involvement of phospholipase-C beta 4 in YAP-active mesothelioma cell proliferation. Carcinogenesis 37, 1098–1109 (2016).
Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A. & Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–308 (2013).
Karnan, S., Ota, A., Konishi, Y., Wahiduzzaman, M., Hosokawa Y., Konishi H. Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide. Nucleic Acids Res. 44:e54 (2016).
Kondo, S., Ota, A., Ono, T., Karnan, S., Wahiduzzaman, M., Hyodo, T., Rahman, M.L., Ito, K., Furuhashi, A., Hayashi, T., Konishi, H., Tsuzuki, S., Hosokawa, Y., Kazaoka, Y. Discovery of novel molecular characteristics and cellular biological properties in ameloblastoma. Cancer Med. 9:2904–2917 (2020).
Karnan, S., Hanamura, I., Ota, A., Takasugi, S., Nakamura, A., Takahashi, M., et al. CD52 is a novel target for the treatment of FLT3-ITD-mutated myeloid leukemia. Cell Death Discov. 7:121 (2021).
Wahiduzzaman, M., Ota, A., Karnan, S., Hanamura, I., Mizuno, S., Kanasugi, J., et al. Novel combined Ato-C treatment synergistically suppresses proliferation of Bcr-Abl-positive leukemic cells in vitro and in vivo. Cancer Lett. 433, 117–130 (2018).
Ito, T., Matsubara, D., Tanaka, I., Makiya, K., Tanei, Z. I., Kumagai, Y., et al. Loss of YAP1 defines neuroendocrine differentiation of lung tumors. Cancer Sci. 107, 1527–1538 (2016).

(Not answered)

Download PDF

Journal Publication

published 21 Jul, 2023

Read the published version in Cell Death Discovery →

Editorial decision: revise
27 Jan, 2023
Review #1 received at journal
17 Jan, 2023
Review #2 received at journal
17 Jan, 2023
Reviewer #2 agreed at journal
19 Dec, 2022
Reviewer #1 agreed at journal
16 Dec, 2022
Reviewers invited by journal
16 Dec, 2022
Submission checks completed at journal
06 Dec, 2022
Editor assigned by journal
05 Dec, 2022
First submitted to journal
05 Dec, 2022

You are reading this latest preprint version

CAMK2D: A Novel Molecular Target for BAP1-Deficient Malignant Mesothelioma

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

BAP1 knockout enhances anchorage-independent cell growth in human mesothelial cells

Gene expression changes induce by BAP1-knockout

Loss of BAP1 expression is associated with histone H3 modification and upregulated CAMK2D expression

BAP1 loss is associated with positive CAMK2D expression in human MM tissues

CAMKII inhibitor KN-93 selectively suppresses the proliferation of BAP1-deficient mesothelioma cells

KN-93 induces significant apoptosis in BAP1-deficient cells

KN-93 suppresses the tumor growth of Y-MESO-9 in xenografted mice

KN-93 administration does not affect body weight and liver and renal functions

Discussion

Materials And Methods

Cell culture

Gene Knockout Using The Clustered Regularly Interspaced Short Palindromic Repeat (Crispr)/cas9 System

Quantitative Rt-pcr (Qrt-pcr)

Cdna Microarray Analysis

Cell Growth Assay

Soft Agar Colony Formation Assay

Western Blot Analysis

Annexin V Assay

Immunohistochemistry (Ihc)

Screening Of Anticancer Drugs Library

Xenograft Experiments

Intracellular Ca Assay

Statistical analysis

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1