All the chemical materials were purchased from Sigma Aldrich company (London, UK) except otherwise stated.
Human Endometrial And Myometrial Tissues Collection
Human uterine tissue was obtained from 5 women in the secretory phase (aged 25–35 years) undergoing hysterectomy for gynecological disorders except for endometrium pathological conditions. Ethical approval was obtained from the Ethics Committee of the Medical Faculty of Tarbiat Modares University with the ethics reference code: IR.MODARES.REC.1397.271 and informed consent were obtained for the usage of human tissues. The tissue specimens were immediately transferred to the laboratory on ice in Dulbecco’s Modified Eagle medium (DMEM). After separating endometrial and myometrial tissues, the samples were washed several times with sterile phosphate-buffered saline (PBS). Then endometrial tissues were cut into fragments (n = 71 fragments in total) in order to decellularize (n = 51 fragments; ∼1–2 cm3) and for isolation of human endometrial cells (n = 20 fragments). The myometrial tissues were washed several times with sterile PBS and then cut into approximately 1 mm3 fragments and were used for myometrial cell isolation.
Experimental Design
After the decellularization of human endometrial fragments, several cell seeding methods by different centrifugation speeds and times in 15 subgroups were studied as summarized in Table. 1. Analysis of residual cell count in suspension was done in all subgroups and the method with the lower amount of suspended cells was selected for subsequent cell seeding. After that, human EMCs and MSMCs were seeded on the decellularized endometrial tissue and co-cultured for one week. The homing, penetration, and differentiation of the seeded EMCs cells to epithelial and stromal-like cells was assessed by morphological and gene expression analysis by real-time RT-PCR.
Decellularization Of Endometrial Tissue
Decellularization was performed according to previous our study [6]. In brief, the endometrial fragments (n = 51) were washed with sterile PBS to remove the remaining blood cells and cell debris. Then, they were subjected to three cycles of freeze/thaw at -80°C and 37°C respectively. After that, the samples were treated with 1% Triton X-100 at room temperature for 15 hours in a rotator (50 rpm) and 1% SDS for 72 h. After that, all decellularized samples were washed with sterile PBS at room temperature in a rotator for 48 hours. The morphology of decellularized and native endometrial tissues (n = 3 in each group) was studied using Hematoxylin and Eosin (H&E) staining.
Isolation And Culture Of Human Endometrial Cells
Human endometrial cells were isolated and cultured as described earlier [19]. Briefly, the endometrial fragments (n = 20) were cut into 1 mm2 piece in DMEM/F-12 with 10% FBS (FBS, Gibco, UK) and antibiotics (100 mg/ml penicillin G sodium, 100 mg/ml streptomycin sulfate). The tissue fragments were digested using collagenase type 1 (300 µg / ml), and deoxyribonuclease type I (40 g / ml) for 90 minutes. Glandular and epithelial components are removed by passing cell suspension through 100 and 40-sieve meshes (BD Biosciences, Erembodegem, Belgium). Endometrial cells were cultured to the fourth passage.
Flow Cytometry Of Human Endometrial Cells
Flow cytometry analysis was performed to assess the isolated endometrial stromal cells for mesenchymal (CD90, CD73, and CD105) and hematopoietic (CD45 and CD34) markers. The cultured endometrial cells (1×105 cells) were suspended in 50 µl of PBS and incubated with direct fluorescein isothiocyanate (FITC)-conjugated antibodies (anti-human CD90, CD73, and CD105; 1:50 dilutions) and direct phycoerythrin (PE)-conjugated antibodies (antihuman CD45 and CD34; 1:50 dilutions) at 4°C for 45 minutes. Then 200 µl of PBS was added and the cells were evaluated with a Partec flow cytometer (Münster, Germany).
Endometrial Mesenchymal Cells Labeling
Before cell seeding, EMCS suspensions were labeled with di-alkyl indocarbocyyanune (DiI) according to the previously described method with some modifications (15). In brief, EMCS suspension (1×105 cells/ml) was exposed to Dil (2 µg/ml, Invitrogen, UK) at room temperature and then placed in a dark place for 20 min at 4°C. The cells were washed 3 times in DMEM/F-12 and the efficiency of cell staining was confirmed under a fluorescent microscope.
Cell Seeding
Cell seeding was performed by centrifugation of DiI-labeled cells with different speeds and times in 15 experimental subgroups (Table 1). In brief, each scaffold (1 mm3) was placed separately at the bottom of the microtubes (Invitrogen, Manchester, UK) containing 300 µI of DiI-labeled cell suspension (1×105 cells/ml) and was subjected to centrifugation as summarized in Table 1. After centrifugal cell seeding, each scaffold was capsulated with 0.5% sodium alginate.
Table 1
Groups | Centrifuge speed | Time |
Group 1 | 500 rpm | 1 min |
Group 2 | 2 min |
Group 3 | 4 min |
Group 4 | 1000 rpm | 1 min |
Group 5 | 2 min |
Group 6 | 4 min |
Group 7 | 1500 rpm | 1 min |
Group 8 | 2 min |
Group 9 | 4 min |
Group 10 | 5000 rpm | 2 min |
Group 11 | 4 min |
Group 12 | 7000 rpm | 2 min |
Group 13 | 4 min |
Group 14 | 10000 rpm | 2 min |
Group 15 | 4 min |
Analysis of Residual Cell Number and Homing of Endometrial Mesenchymal Cells by LSCM The number of residual cells per millimeter cell suspension in supernatants of all subgroups were counted by hemocytometer slide. The recellularized scaffolds with lower residual cell numbers (subgroups 12 and 13), were cultured in 96-well plates in DMEM/F12 containing 10% FBS, 75 µg/ml streptomycin, 100 IU/ml penicillin and 1% (v/v) amphotericin-b at 37°C in 5% CO2 for 7 days. The medium was changed every two days during the cultural period. After one week of in vitro culture, the recellularized scaffolds in subgroups 12 and 13 (n = 3 in each group) were examined by LSCM (ZEISS LSCM 800, Germany) with an excitation wavelength of 546 nm and emission wavelength of 563 nm. Sequential images were captured with a thickness of 5 µm along the Z-axis. Then cell count was performed using the Imaris Software (Bitplane, Zürich, Switzerland).
In Vitro Culture Of Human Myometrial Cells
Myometrial cells were isolated via the tissue explant method [19]. In brief, myometrial tissue was washed several times with sterile PBS and then cut into approximately 1 mm3 size fragments. Then these pieces (n = 20) were cultured in DMEM / F12 medium containing 10% FBS, 75 µg/ml streptomycin and 100 IU/ml penicillin antibiotics, and 1% (v/v) amphotericin-b at 37°C, 95% humidity and 5% CO2 for three weeks. During the culture period, the medium was replaced with a fresh culture medium every two days.
Immunocytochemistry Of Human Myometrial Cells
In this research, immunohistochemistry was used to confirm the nature of cultured myometrial cells by evaluating the expression of α-SMA as a smooth muscle cell marker. The myometrial cells (n = 3) were cultured on coverslips then washed three times with PBS and fixed by 4% paraformaldehyde at 4°C for 45 min. After permeabilizing the cells with 0.3% Triton X- for 15 min, they were pre-incubated with the 2% solution of serum for 1 hour. Slides were incubated with primary antibody diluted with PBS for 50 minutes at room temperature. Finally, the cells were incubated with the secondary antibody that was conjugated with Horseradish peroxidase in a dark condition for 90 minutes at room temperature. The nuclei were counterstained with Mayer’s Hematoxylin for 5 minutes. For negative controls, the primary antibody was omitted. The immunostained MSMCs were visualized under light microscopy.
Labeling Of Human Msmcs
For MSMCs labeling, Hoechst 34580 stain (Sigma, Germany) dissolved in distilled water (1 ng/ml). Then 300 µI of cell suspension (1×105 cells/ml) were incubated with stain solution at 37°C in dark condition for 1 hour. The efficiency of cell staining was confirmed under a fluorescent microscope, and finally, the cells were washed 3 times with PBS.
Co-culturing Of Human Endometrial Mesenchymal And Myometrial Cells On Decellularized Scaffold
A mixture of an equal number of labeled EMCs and MSMCs (1×105 cells/ml suspension) was added to the scaffold (size ∼1 mm3) within microtubes (Invitrogen, Manchester, UK). The microtubes were centrifuged at 7000 rpm for 2 minutes (according to the earlier experiment). Then, each scaffold was capsulated with 0.5% sodium alginate and cultured in 96-well plates containing DMEM/F12 supplemented with 10% FBS, 75 µg/ml streptomycin, 100 IU/ml penicillin and 1% (v/v) amphotericin-b at 37°C in 5% CO2 for 7 days. During the cultural period, the medium changed every other day.
Live & Dead Assessment Of Co-cultured Cells On Decellularized Scaffold
The viability of the cultured cells in decellularized scaffolds (n = 3) was assessed using a live/dead viability kit (L-3224, Invitrogen, USA) according to the manufacturer’s instructions. In brief, the cells were incubated with Calcein AM (green) and ethidium homodimer-1 (EthD-1, red) at room temperature in a dark place for 30–45 minutes. Then, the viability of the cells in the recellularized scaffold was observed under LCSM (ZEISS LSM 800, Germany).
Lscm Observation Of Co-cultured Cells On Decellularized Scaffold
The recellularized scaffolds were examined by LSCM with excitation and emission wavelength of 546 and 563 nm for DiI-labeled cells and 392 and 440 nm for Hoechst-labeled cells respectively. Sequential images were captured with a thickness of 5 µm along the Z-axis and each cell type count per volume unit using the Imaris Software (Bitplane, Zürich, Switzerland).
H&e Staining Of Recellularized Scaffold
The recellularized scaffolds (n = 3) were fixed with 4% paraformaldehyde and dehydrated with ascending concentrations of ethanol, and finally embedded in paraffin wax. The tissue sections at 5 µm thickness were prepared and stained with H&E and observed under light microscopy.
Scanning Electron Microscopy (Sem) Study Of Recellularized Scaffold
For the SEM study, the samples of the recellularized and the control scaffolds (n = 3 in each group) were fixed by 2.5% glutaraldehyde for 2 hours. After dehydration in ascending series of ethanol they were treated with a solution of hexamethyldisilazane (HMDS) and ethanol in a ratio of 1:2 for 20 minutes, and 2:1 for 20 minutes. Then, the samples were incubated in 100% HMDS overnight. Afterward, the samples were coated with gold particles and examined by SEM (VEGA/TESCAN-XMU, Czech Republic).
Gene Expression Analysis Of Co-cultured Cells
RNA extraction was performed by TRIzol® Kit (Thermo Fisher Scientific, Bremen, Germany) according to the manufacturer's protocol. RNA quantification was evaluated by spectrophotometric reading at 260 nm. Extracted RNA was treated with DNase (DNase I, RNase-free; Thermo Fisher Scientific, EU) to eliminate any genomic DNA contamination. cDNA preparation was done using a cDNA synthesis kit (Thermo Fisher Scientific, Bremen, Germany) according to the manufacturer’s protocol. Relative mRNA expression was investigated by a StepOnePlus real-time RT-PCR system (Applied BioSystems, USA) using QuantiTect SYBR Green RT-PCR kit (Qiagen, Hilden, Germany). Relative quantification analysis was performed using the 2−ΔΔCT method. The primers of the LAMA2, COL4A1, ZO-1, SPP1, MMP2, and OCT4 genes were designed by AlleleID software (Primier Biosoft, USA) and the Ef1 gene was used as housekeeping gene as summarized in Table 2.
Table 2
Characteristics of primers used for the real-time reverse transcription-polymerase chain reaction assay
Target gene | Primer pair sequences (5'–3') | Accession number | product size (bp) |
EF1 | F | 5'TTGTTGCTGCTGGTGTTG3' | NM_001402.6 | 160 |
R | 5'TCATATCTCTTCTGGCTGTAGG3' |
ZO-1 | F | 5'GAGGATGAAGATGAAGATGGT3' | NM_003257.5 | 183 |
R | 5'TGGAAGGATGCTGTTGTC3' |
COL4A1 | F | 5'AGGAGCGAGATGTTCAAG3' | NM_001845.6 | 148 |
R | 5'AAGAAGAAGAAGTAGCACCAT3' |
LAMA2 | F | 5'TGCTCTTATCACGACCAAT3' | NM_000426.4 | 284 |
R | 5'CTGCCTTCACAATCACATAC3' |
SPP1 | F | 5'TCTGATGAATCTGATGAACTG3' | NM_000582.3 | 194 |
R | 5'GTGATGTCCTCGTCTGTA3' |
MMP2 | F | 5'GGAGATACAATGAGGTGAAGAAGA3' | NM_004530.6 | 96 |
R | 5'CGACGGCATCCAGGTTAT3' |
OCT4 | F | 5'CGATCAAGCAGCGACTATG3' | NM_002701.6 | 86 |
R | 5'GCCAGAGGAAAGGACACT3' |
Statistical Analysis
Statistical analysis was performed using SPSS version 24 software (SPSS Inc., Chicago, IL, USA). The normal distribution of data was investigated with the Shapiro-Wilk normality test. One-way analysis of variance (ANOVA) and the Kruskal-Wallis test was performed for the parametric and non-parametric distribution respectively. Post hoc Tukey's Honest Significant Difference (HSD) test was done for the pairwise comparison of means. A P-value less than 0.05 was considered statistically significant. The data are presented as mean ± SD. Each experiment was repeated at least three times.