Human iPSC culture and generation of IL1RAPL1 Knock-out clones
CRISPR design included two single guide RNAs (sgRNAs) targeting 5’ end of exon 3 (IL1RAPL1 sgRNA1 – AGACAGTCAGTGCATCCAT) and 3’ end of exon 5 (IL1RAPL1 sgRNA2 – ACTACTGAATTAACTGTTAC), which were designed using the CRISPOR tool (http://crispor.tefor.net/). The guide RNAs were validated for precision and high frameshift frequency using inDelphi (https://indelphi.giffordlab.mit.edu).
Kolf_2C1 hiPS cells were purchased from the Wellcome Trust Sanger institute (https://hpscreg.eu/cell-line/WTSIi018-B-1). The iPSCs were maintained and manipulated using essential 8 medium kit (Thermo Fisher Scientific A1517001) and Vitronectin (Thermo Fisher Scientific CTS279S3). To generate IL1RAPL1 KO clones, both sgRNA1 and sgRNA2 were used simultaneously in a Cas9 (IDT HiFi Cas9 1081061)/ sgRNA RNP complex to excise 116kb genomic DNA. Briefly, 100,000 single cells were electroporated with the RNP complex at 1200 volts, 30ms, and 2pulses using Neon electroporation. The cells were seeded in one well of a 48 well plate with E8 medium containing 1X Revitacell supplement (Thermo Fisher Scientific A2644501). 48 hours after electroporation the cells were seeded at ultralow density for monoclonal expansion and genotyping. Single clones were assessed for targeted excision by the deletion specific PCR using 5F (CAGCAGAAGCAGACTCAGTG) and 3R (ATTTGGAGCAAGACAGGAAGACA) primers.
The zygosity of the identified clones were confirmed using PCRs for the wild type sequence using 5’ (5F- CAGCAGAAGCAGACTCAGTG / 5R- GTAGCAATGTTGGCCGGAAC) and 3’ (3F- TCTGTTTCCAAAATGATGTCACGG / 3R- ATTTGGAGCAAGACAGGAAGACA) genomic amplification. Clones positive for the deletion PCR and negative for both the wild type PCRs were expanded for quality control. Pluripotency of the CRISPR edited clones was assayed through flow cytometry using BD stem cell transcription factor analysis kit (BD Biosciences, 560477). Metaphase spreads were prepared and diploid chromosome number were confirmed by counting 25 spreads for each clone.
Neurospheres Assay
We differentiated IPSC clones into cortical lineage neuronal progenitor cells using established methodology15, 17. We carried out live cell neurosphere assays using IL1RAPL1 KO and WT iPSC clones. On day 25, the cells were dissociated into single cells using Accutase (Gibco™ A1110501) and approximately 10,000 neuronal progenitors were reaggregated in 96-well V-bottom plates to form three dimensional neurospheres. After 24 hours, the neurospheres were transferred to a 24 well plate coated with GFR matrigel (Corning, 354230). The neurospheres were incubated with live imaging probes SiR-Tubulin and SPY-555-DNA at 100 nM concentration two hours prior to live imaging. All images were acquired using an Olympus IXplore Spin-SR, using a 50 µm pinhole confocal spinning disk and a Hamamatsu ORCA Fusion BT camera. Every 30 minutes 140 µm z-stacks with a z spacing of 10 µm were over a total time course of 48 hours. See supplementary table 3 for individual channel and filter details are presented in supplementary table 5. Live cell migration analysis was performed using automated analysis pipeline created in Arivis AG, Germany (www.arivis.com). This identified the area of migrating progenitor cells and radial fibre regions based on tubulin staining at each timepoint.
Neuronal Differentiation And Synaptosome Isolation
Neuronal progenitors were further differentiated in 2D culture to generate cortical neurons17. On days 27–31, the cells underwent final passage using Accutase at a ratio of 1:4 onto laminin-coated 24-well plates. The cells were cultured for another 60 days after the last passage, with medium changes every second day. The presence of both CTIP2 expressing deep layer and BRN2 expressing upper layer neurons were confirmed using immunofluorescence. The cortical neurons were used in immunofluorescence experiments to investigate synapse formation. Also, cortical neurons were used to generate synaptosomes as described previously18. Briefly, cortical neuronal cultures were collected, homogenized, and purified using the Syn-PER Synaptic Protein Extraction Reagent (Thermo Fisher Scientific). This was followed by repeated centrifugal fractionation and the pellet containing synaptosomes was used for microglia phagocytosis assays.
Microglia Differentiation
iPSC clones were differentiated into microglia as described before19. Briefly, iPSCs were seeded into AggreWell plate (STEMCELL) with E8 media (Gibico) supplemented with 50 ng/mL BMP4 (ThermoFisher), 50 ng/mL VEGF (ThermoFisher) and 20 ng/mL SCF (Miltenyi Biotech) for 4 days to generate Embryoid Bodies (EBs). The EBs were transferred and allowed to attach in T175 flasks and with factory medium containing in XVIVO-15 media (Lonza) supplemented with 25 ng/mL IL-3 (Gibco), GlutaMax, 2-mercaptoethanol, and 100 ng/mL M-CSF. After 4–5 weeks, macrophage precursors were harvested and passed through a 40µm cell strainer. The macrophage precursors were differentiated in microglia medium (supplementary table 3) containing N2 + IL34 + GM-CSF for 2 weeks until they acquired ramified microglia morphology on a 24-well optical bottomed plates (Ibidi 82426).
Immunofluorescence
Cells were fixed in 4% paraformaldehyde for 15 minutes. The cells were permeabilized using 0.1% Triton-X100 in PBS and blocked for 1 hour with 5% fish gelatin and 0.3M glycine in PBS. Subsequently, the cells were stained with primary antibodies to MAP2 (Abcam, ab5392), PSD95 (Cell Signaling Technologies 36233) TMEM119 (Cell Signaling Technologies 90840), BRN2 (Cell Signaling Technologies 12137), CTIP2 (Cell Signaling Technologies, 12120) diluted in blocking solution at 4°C overnight (supplementary table 4). The cells were washed and incubated with secondary antibodies (Goat anti-Mouse IgG Alexa Fluor™ 488, Invitrogen A11029, Goat anti-Rabbit IgG, Alexa Fluor™ 568, Invitrogen A11036, Goat anti-Chicken IgY (H + L) Secondary Antibody, Alexa Fluor™ 647, Invitrogen A21449) diluted 1:1000 in PBS, for 1 hour at room temperature. Also, the cells were stained with 1 µM DAPI. Images were acquired using an Olympus IXplore Spin-SR, using a 50 µm pinhole confocal spinning disk and a Hamamatsu ORCA Fusion BT camera.
Statistical analysis
The association between time and the following outcomes: 1) radial glia growth and 2) neural migration, was explored using two linear mixed effect regression models:
Model 1: Outcome ~ Time + Deletion Status (1 + Time|Neurospheres)
Model 2: Outcome ~ Time × Deletion Status (1 + Time|Neurospheres)
The first model included one fixed effects parameter, deletion status (knockout vs. wild type), and included two separate regression lines for knockout and wild type. Each line had different starting points (i.e. intercepts) but the same rate of change in outcome (i.e. identical slopes). The second model included two fixed effects parameters, status and an interaction term between deletion status and time. This model therefore has different starting points (i.e. intercepts) and different rates of change in outcome (i.e. different slopes). Both models included the following random effects parameters: 1) each neurosphere sample (i.e. random intercepts) and 2) average change in outcome per unit time for each neurosphere sample (i.e. random slopes). A likelihood ratio test was carried out to identify the model with a better fit to the data. All analyses were carried out using R, version 4.2.2.
For fixed image analyses, comparisons between wild type and knock-out neurons were carried out using the 2-tailed student’s t-test for mean intensity of PSD-95. Poisson regression was used to compare counts of PSD-95 clusters between wild-type and knock-out neurons. For neuron and microglia knock-out experiments, the relative mean intensity of PSD-95 in four independent groups (WT neuron/WT microglia, WT neuron/KO microglia, KO neuron/WT microglia, KO neuron/WT microglia) were compared using a one-way ANOVA.