The potential role of lipopeptide biosurfactant generated by Acinetobacter junii B6 on Leishmania tropica: The synergy of lipopeptide biosurfactant and Glucantime

doi:10.21203/rs.3.rs-2328840/v1

An in vitro investigation was carried out to assess how the lipopeptide biosurfactant (LPB) produced by Acinetobacter junii B6 affects Leishmania tropica infection and the associated cytokine gene expression in macrophages infected with L. tropica. Glucantime® (meglumine antimoniate, MA) and LPB were investigated for their leishmanicidal effect, alone and in combination (LPB + MA), using a colorimetric test and a macrophage model. Immunomodulatory impact was also evaluated through analysis of Th1 and Th2 cytokine gene expression in infected macrophages after treatment with MA and LPB, individually and in combination. The MA/LPB combination showed higher inhibitory impacts on L. tropica amastigotes and promastigotes than each alone. Cytokine gene expression confirmed LPB’s affinity to IFN-γ, affirming the elevated IL-12p40 and IFN- γ concentrations in addition to a reduction in the secretion of IL-10 in a dose-dependent manner, particularly in combined treatment. The results indicated higher effectiveness of LPB along with MA in the reduction of the parasite growth and promoting the immune reaction level, which may be considered as a possible therapeutic strategy to treat those with anthroponotic cutaneous leishmaniasis.

Lipopeptide biosurfactant

Acinetobacter junii B6

Leishmania tropica

Glucantime

Leishmaniasis is an important global disease and health concern with no effective treatment. Eco-effective compounds against cutaneous leishmaniasis are highly sought after. The usage of existing treatments of leishmaniasis such as MA has consequently expanded, however is has also resulted in increasing environmental concerns because of the toxicity and structure of the drug [1]. Searching for sustainable and renewable treatment or control drug or methods, such as employing environment-friendly treatments, has pointed to the potential application of biosurfactants as possible solutions [2]. Biosurfactants have been reported to have some antibacterial, antifungal and anticancer properties [3]. Biosurfactants are surface-active compounds characterized by hydrophobic and hydrophilic parts; they can be produced by various microorganisms, like yeasts, bacteria, and fungi, and are divided into glycolipids and lipopeptide groups [4]. Because the compounds exhibit higher biodegradability and lower toxicity, they can be used in many biomedical fields such as antileishmanial activities [5]. Recent studies have shown that LPB or combination therapies of existing medications with synergistic impacts may highlight a novel approach to treat pathogens [6]. It has been shown that these amphiphilic compounds may be able to inhibit Plasmodium falciparum development through interfering with Sirtuins 2 (SIR2) activity [7]. Sirtuins are NAD-dependent nonhistone and histone deacetylases that regulate important cellular processes in parasites and promote the amastigotes survival through the prevention of programmed cell death [8]. Recently, biosurfactants have been considered as possible biomedical agents with expressed immunological properties [9]. Biosurfactants have been shown to have immunomodulatory properties, supporting the development of the Th1 immune response. The importance of CD⁴⁺ Th1 cells in generating IL-12 - and IFN, as well as infection healing, has been demonstrated in animal model studies, as opposed to Th2 cells' function in disease development through IL-10 [10]. Therefore, the disease outcome in mice affected by cutaneous leishmaniasis can be associated with the balance of Th1/Th2 cytokines [11]. Since traditional therapy has presented significant obstacles, substituting new drugs or combining therapies may be a viable alternative for an improved treatment [11]. LPB produced by A. junii B6 is diverse and complex structures including a hydrophobic fatty acid part, linking to a hydrophobic peptide chain. In addition to their high surface activity, these amphiphilic molecules have shown a wide biological activity spectrum such as antimicrobial, antibiofilm, and cytotoxicity activities [3, 12]. Using colorimetric methods, this study primarily aimed to evaluate the inhibitory effects of LPB in vitro, alone and combined with MA, on amastigote and promastigote types of L. tropica. The intra-macrophage amastigote was applied for assessing their immunomodulatory impact in combination and individually via measurements of cytokine gene expression profiles.

Preparation of the LPBs

The LPB was prepared according to Ohadi et al.[12, 13]. Briefly, LPB was prepared by A. junii B6 (GenBank accession KT946907) already separated from oil-contaminated soil. The prepared LPB was subjected to purification in two steps acid precipitation and solvent extraction. Based on the analytical characterization indicated via spectroscopy assessment, the proposed structure was approved.

The Cytotoxicity Assays

The J774A.1 murine macrophage cell line was prepared from Pasteur Institute, Iran. Cells were kept in RPMI 1640 medium treated with 100 U/ mL penicillin G, 15% fetal bovine serum (FBS), and 100µg/mL streptomycin at 37°C in a humidified room with 5% CO₂. For evaluating the cytotoxicity of LPBs and MA, cell lines were treated with various levels of drugs (5-500µg/mL) for 72 h in 5% CO₂ at 37°C in 96-well tissue culture plates. The control group wells contained cells and the medium without any drugs. After 72 h incubation, MTT [3- (4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (5µg/mL, Sigma Aldrich, USA) powder was used according to manufacturer instructions to perform the MTT test on the J774A.1 cell line. Reading of optical density (OD) was carried out at 490nm by the BioTek-ELX800 ELISA reader. The 50% inhibition level (IC₅₀) cytotoxicity value was calculated by SPSS 21 after the viability inhibition rate was plotted against concentration. The 50% cytotoxicity concentration (CC₅₀) was assessed by the Probit test. The experiments were carried out in triplicates [14].

Parasite Culture And Anti-promastigote Test

Promastigotes of L. tropica (MHOM/IR/ 2002/Mash2) were prepared by the Research and Training in Skin Diseases and Leprosy Center, Iran. For mass production, the promastigotes were grown in 24- well microtiter plates containing RPMI1640 media (Biosera, France) supplemented with 10% heat-inactivated FBS (Gibco, Germany) and antibiotics (penicillin (100 IU/ml) and streptomycin (100µg/ml). Anti-promastigote assessments were carried out using direct counting assay according to growth inhibition. The promastigotes were grown at an initial level similar to the level of early log phase (10⁶ promastigotes/ml) and followed by multiplying for 72h at 25°C. Afterward, the promastigotes were treated in different groups: 1) LPBs (50–300µg/mL), 2) LPBs plus MA as test groups, and 3) MA as a reference agent (50–300µg/mL). Promastigotes with no drug and complete medium with no organism were respectively applied as positive and negative controls. The MTT solution (10µl) was mixed with each well after incubation for 4 h at 25°C. Isopropyl alcohol was used to terminate the reaction, which was then assessed using the BioTek-ELX800 ELISA reader at 490 nm. The value of IC₅₀ was determined through the Probit test and SPSS 21. All experimental procedures were carried out three times [11].

Anti-amastigote Assay

Following the placement of sterile 1 cm² coverslips in the wells, 6-chamber slides (Lab-Tek, Nalge Nunc International NY, USA) recieved 100 µl murine macrophages (10⁶ cells/mL), followed by incubation for 4h at 37°C with 5% CO₂. Then, non-adherent cells were removed and stationary-phase Leishmania + macrophage was added to the wells (10:1 ratio) for 24 h under similar conditions [15]. Following exposure and removing free parasites, various levels of 50–300 µg/mL LPBs, MA, and the combination of LPBs and MA were applied for treating the affected cells in 5% CO₂ at 37°C for 72 h. Then, six dried slides were stained using methanol and Giemsa, and a light microscope was used to evaluate them. Macrophages alone were considered negative controls and infected macrophages without drugs were considered positive controls. The drug leishmanicidal impact was assessed using the average number of amastigotes per 100 macrophages [11].

Evaluation Of The Expression Level Of Cytokines

Control samples and treated macrophages were assessed by quantitative real-time PCR (qPCR) analysis for variations in IL-12p40, IFN-γ, and IL-10 expression levels. The Th-1 pathway was presented by genes corresponding to IFN-γ and IL-12 p40 whereas the Th-2 pathway was presented by the IL-10 gene [16]. In brief, the extraction of total RNA was carried out using treated and untreated groups by the RNeasy Mini Kit (Cat. No. 74106, Qiagen, Germany) as per instructions. The quality and quantity of extracted RNA were calculated using 2% agarose gel electrophoresis and Nanodrop (ND-2000, Thermo Scientific Fisher, US), respectively. Extracted RNA (500 ng) in a FlexCycler (Analytik Jena, Germany) was used with the RT reagent Kit (Takara, Japan) at 37°C for 15 min to synthesize cDNA. A qPCR system (Rotor- Gene Q, Qiagen) was used according to manufacturer instructions to perform the qPCR reaction in 15 µl using SYBR® Premix Ex TaqTM II (Japan). The reference gene sequences, and specific primers are shown in Table 1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference gene for normalization purposes with a no-cDNA specimen as the negative control. The experiments were carried out in triplicate.

Table 1

The qPCR primers and reference gene sequences.
Template	Forward and reverse sequences (5´-3´)	Product size (bp)
IL-12P40	F-CTGGAGCACTCCCCATTCCTA R- GCAGACATTCCCGCCTTTG	160
IL-10	F-CTTACTGACTGGCATGAGGATCA R- GCAGCTCTAGGAGCATGTGC	101
IFN-γ	F-CAGCAAGGCGAAAAAGGATG R- TGGTGGACCACTCGGATGA	106
GAPDH	F-AGCTTCGGCACATATTTCATCTG R- CGTTCACTCCCATGACAAACA	89

Statistical analysis

Values were reported as mean ± SD. One-way ANOVA was applied for comparison between the experiment and control groups. Variations of IC₅₀ in Nam and MA groups were compared with a t-test at p < 0.05. Prism 7.01 software was used for data analyses.

Cytotoxic assay

The drug was applied to macrophages at different concentrations (50–300µg/mL), and the CC₅₀ was determined for each drug (Table 2). LPB had less cytotoxicity than MA on macrophages, whereas the CC₅₀ of LPB was 315.5 ± 0.19 µg/ml and MA was 214.2 ± 0.61µg/ml (Table 2).

Table 2

Evaluating the IC₅₀ values of LPB in promastigote and amastigote forms of *L. tropica* compared to the positive control of MA (glucantime®) as well as the CC₅₀ value of macrophage.
Drugs	Amastigote		Promastigote		Macrophage	^cSI
Drugs	^aIC₅₀ ± SD (µg/mL)	P -value	^aIC₅₀ ± SD (µg/mL)	P -value	^bCC₅₀ (µg/mL)	(Selectivity Index)
LPB	38.5 ± 0.01	NR	88.3 ± 0.01	NR	315.5 ± 0.19	8.2
MA^d	65.9 ± 0.03	P < 0.001	208.9 ± 0.03	P < 0.001	214.2 ± 0.61	3.5
LPB + MA^d	19.04 ± 0.01	P < 0.001	31.9 ± 0.01	P < 0.001	265.2 ± 0.36	13.9
NR: Not related.
^aIC₅₀: Concentration inhibiting 50% of promastigotes and amastigotes.
^bCC₅₀: Concentration inhibiting 50% of macrophages.
^cSI: Selectivity index (CC₅₀/IC₅₀).
^dMA: Glucantime®.

Anti-promastigote Activity

The anti-promastigote activities of LPB, MA and LPB + MA on the L. tropica promastigote form were determined by MTT assay (Fig. 1a). The inhibition percentages were dose-dependent, with increased inhibition at increasing concentrations. The LPB, MA, and LPB + MA IC₅₀s were 88.3 ± 0.01, 208.9 ± 0.03, and 31.9 ± 0.01µg/mL, respectively (Table 2). LPB + MA showed a lower IC₅₀ value than the positive control (MA) (p < 0.001) (Table 2). LPB + MA displayed the highest inhibitory effects compared with LPB or MA alone (Fig. 1a)

Anti-amastigote Activity

The anti-amastigote activity of drugs was evaluated in L. tropica -infected macrophage cultures (Fig. 1b). Calculation of the IC ₅₀ values for LPB, MA and LPB + MA against amastigotes revealed IC₅₀ of 38.5 ± 0.01µg/ml, 65.9 ± 0.03µg/mL, and 19.04 ± 0.01µg/mL respectively. The combination of LPB + MA showed lower IC₅₀ value in comparison to the LPB or MA treatment alone (Table 2). The combination of LPB/MA has a selectivity index (SI) value of 13.9, indicating that it does not even have a substantial cytotoxicity effect on mammalian macrophages.

Gene Expression

T cell-mediated immune response gene expression was examined in MA, LPB, the combination of LPB and MA, and untreated control (UC) cells. IL-10 (Th2 cell-related parameter) and IL-12P40 and IFN-γ (Th1 cell-related parameters) were all expressed (Fig. 2a-c). Compared to untreated cells, Th1-related parameter transcription factors and expression were markedly higher in the LPB, MA, and LPB + MA groups. When LPB and MA were combined, Th1 transcription factors and cytokines significantly increased while there was substantial reduction in Th2 cytokine expression when compared to LPB and MA alone (P < 0.001). The effects of Th2-related cytokine downregulation and Th1-related transcription factor and cytokine overexpression on survival of parasites are shown in Fig. 2.

Leishmaniasis typically affects infected human’s health for many years, which is a major public health problem globally. The use of existing treatments of leishmaniasis are extremely challenging because of their toxicity, high cost, low efficacy, and side effects [17]. Treatment using combinations of available drugs and natural products has attracted interest in recent years as an excellent alternative to address the various issues associated with the management of this parasitic infection [18]. Since safety and biocompatibility are two ideal features of antiparasitic therapeutic agent, biosurfactants were considered an potential promising alternative therapies because of their lower toxicity and higher biodegradability properties [19]. The main effect of biosurfactants have been evaluated in various protozoa, such as Plasmodium falciparum [7], the Nosema ceranae [20], and the Ichthyophthirius multifiliis [19]. In our study, the antileishmanial effect and cytokine expression levels of LPB, alone and combined with MA, against L. tropica were assessed. Our results indicated that the use of LPB + MA (compared to MA or LPB alone) on promastigotes resulted in the highest inhibition and the lowest IC₅₀. Also, the average intra-macrophage amastigote count was markedly lower when LPB was combined with MA compared when they were used alone. In general, combination therapies are more effective compared to a single drug treatment [6].

The LPB /MA mode of action is possibly because of interaction with the parasite membrane increasing the activity of antiparasitic drugs through the formation of pores in the outer membrane leading to facilitation of the MA entrance through the cytoplasmic membrane [20]. Rivardo et al. [6] reported that Bacillus licheniformis V9T14 produces an amphiphilic LPB that can treat Escherichia coli CFT073 biofilm by delivering antibiotics into an extracellular polymeric substance to enhance the impact of the antibiotics against the biofilm. There are various mechanisms associated with growth inhibition by LPB in various parasites. The suggested hypothesis is that the amphiphilic features of LPBs destroy the cell structure through their action on the lipid bilayer and cell proteins, leading to the death of the parasite [19, 20].

Previous studies showed that the LPB such as surfactin has a lethal effect on the Plasmodium falciparum by inhibiting Sir2. SIR2 protein is essential for the survival and proliferation of parasites. Surfactin is a new Sir2 inhibitor representing competitive inhibition considering NAD⁺ and uncompetitive inhibition with acetylated peptide [7]. Such inhibition pattern with surfactin can provide more support for the observed antiparasitic activity of LPB. It has been indicated that microbial surfactants possess an ability to regulate inflammation-associated genes, which suggests that biosurfactants may have an immunomodulatory effect [10]. Inflammatory reactions were also associated with the parasite infection, which is in line with our results, indicating immune response progression through higher secretion of Th1 pathway cytokines ( IL-12P40 and IFN-γ) and also lower secretion of the Th2 cytokine IL-10 in treatment by the LPB + MA combination compared to LPB or MA alone. Microbial biosurfactant molecules are usually identified by Toll-like receptors available on different kinds of cells. The bacterial cell wall components activate monocytes and neutrophils leading to high secretion of pro-inflammatory cytokines (IL-12, IFN-γ) [21]. Konig et al. [22] reported similar findings where they proposed enhanced inflammatory mediator release by human platelets by Pseudomonas aeruginosa glycolipid.

The use of LPB + MA combination demonstrated higher inhibitory effectiveness against the L. tropica growth in a macrophage model through the promotion of immune response levels. Thus, LPB combined with MA is a valuable source as well as promising option for anti-leishmanial drug development in anthroponotic cutaneous leishmaniasis cases in clinical settings. In addition, our findings open a new area of exploration to develop novel therapeutic strategies to deal with different leishmaniasis variations, and, possibly, similar protozoan parasites.

Acknowledgments

The authors would like to thank Kerman University of Medical Sciences (KMU) for facilitating relevant research towards the completion of this investigation.

Funding

The funding source(s) had no such involvement in the manuscript

Ethics declarations

Ethical Approval

Not applicable.

Consent to Participate

I confirm that the final manuscript has been seen and approved by all the authors.

Consent to Publish

We hope that you will find our manuscript acceptable for publication in the above journal.

Conflict of Interest

The authors declare no competing interests.

F. Bailey, K. Mondragon-Shem, L.R. Haines, A. Olabi, A. Alorfi, J.A. Ruiz-Postigo, J. Alvar, P. Hotez, E.R. Adams, I.D. Velez, Cutaneous leishmaniasis and co-morbid major depressive disorder: a systematic review with burden estimates, PLoS neglected tropical diseases 13(2) (2019) e0007092.
S.S. Mohanty, Y. Koul, S. Varjani, A. Pandey, H.H. Ngo, J.-S. Chang, J.W. Wong, X.-T. Bui, A critical review on various feedstocks as sustainable substrates for biosurfactants production: a way towards cleaner production, Microbial cell factories 20(1) (2021) 1-13.
M. Ohadi, H. Forootanfar, G. Dehghannoudeh, T. Eslaminejad, A. Ameri, M. Shakibaie, M. Adeli-Sardou, Antimicrobial, anti-biofilm, and anti-proliferative activities of lipopeptide biosurfactant produced by Acinetobacter junii B6, Microbial pathogenesis 138 (2020) 103806.
A.I. Adetunji, A.O. Olaniran, Production and potential biotechnological applications of microbial surfactants: An overview, Saudi Journal of Biological Sciences 28(1) (2021) 669-679.
A. ABD BURGHAL, W.H. AL TIMIMI, A.A.-U. AL-HILFI, Antibacterial and Antiparasitic Biosurfactants Produced by Candida Cruzi in Different Nitrogen and Carbon Sources, International Journal of Pharmaceutical Research 13(2) (2021).
F. Rivardo, M.G. Martinotti, R.J. Turner, H. Ceri, Synergistic effect of lipopeptide biosurfactant with antibiotics against Escherichia coli CFT073 biofilm, International journal of antimicrobial agents 37(4) (2011) 324-331.
S.P. Chakrabarty, Y.K. Saikumari, M.P. Bopanna, H. Balaram, Biochemical characterization of Plasmodium falciparum Sir2, a NAD+-dependent deacetylase, Molecular and biochemical parasitology 158(2) (2008) 139-151.
B. Vergnes, D. Sereno, N. Madjidian-Sereno, J.-L. Lemesre, A. Ouaissi, Cytoplasmic SIR2 homologue overexpression promotes survival of Leishmania parasites by preventing programmed cell death, Gene 296(1-2) (2002) 139-150.
M.D. Subramaniam, D. Venkatesan, M. Iyer, S. Subbarayan, V. Govindasami, A. Roy, A. Narayanasamy, S. Kamalakannan, A.V. Gopalakrishnan, R. Thangarasu, Biosurfactants and anti-inflammatory activity: A potential new approach towards COVID-19, Current Opinion in Environmental Science & Health 17 (2020) 72-81.
M. Sajid, M.S.A. Khan, S.S. Cameotra, A.S. Al-Thubiani, Biosurfactants: potential applications as immunomodulator drugs, Immunology Letters 223 (2020) 71-77.
R.T. Oliaee, I. Sharifi, M. Bamorovat, A. Keyhani, Z. Babaei, E. Salarkia, R. Tavakoly, A. Khosravi, M. Mostafavi, F. Sharifi, The potential role of nicotinamide on Leishmania tropica: An assessment of inhibitory effect, cytokines gene expression and arginase profiling, International Immunopharmacology 86 (2020) 106704.
M. Ohadi, G. Dehghannoudeh, M. Shakibaie, I.M. Banat, M. Pournamdari, H. Forootanfar, Isolation, characterization, and optimization of biosurfactant production by an oil-degrading Acinetobacter junii B6 isolated from an Iranian oil excavation site, Biocatalysis and Agricultural Biotechnology 12 (2017) 1-9.
M. Ohadi, G. Dehghannoudeh, H. Forootanfar, M. Shakibaie, M. Rajaee, Investigation of the structural, physicochemical properties, and aggregation behavior of lipopeptide biosurfactant produced by Acinetobacter junii B6, International Journal of Biological Macromolecules 112 (2018) 712-719.
C. Paris, P.M. Loiseau, C. Bories, J. Bréard, Miltefosine induces apoptosis-like death in Leishmania donovani promastigotes, Antimicrobial agents and chemotherapy 48(3) (2004) 852-859.
F. Mohseni, I. Sharifi, R.T. Oliaee, Z. Babaei, M. Mostafavi, P.G.N. Almani, A. Keyhani, E. Salarkia, F. Sharifi, H.H. Nave, Antiproliferative properties of Turmerone on Leishmania major: Modes of action confirmed by antioxidative and immunomodulatory roles, Comparative Immunology, Microbiology and Infectious Diseases 84 (2022) 101797.
M. Nooshadokht, M. Mirzaei, I. Sharifi, F. Sharifi, M. Lashkari, B. Amirheidari, In silico and in vitro antileishmanial effects of gamma-terpinene: Multifunctional modes of action, Chemico-Biological Interactions 361 (2022) 109957.
S. Imane, B. Oumaima, K. Kenza, I. Laila, S. Zineb, A Review on Climate, Air Pollution, and Health in North Africa, Current Environmental Health Reports (2022) 1-23.
M.L. de Souza, W.M. Dos Santos, A.L.M.D. de Sousa, L.R.d.M. Ferraz, L.A.G. da Costa, E.O. Silva, P.J. Rolim Neto, Cutaneous leishmaniasis: new oral therapeutic approaches under development, International Journal of Dermatology 61(1) (2022) 89-98.
A. Al‐Jubury, C. Lu, P. Kania, L. von Gersdorff Jørgensen, Y. Liu, I. De Bruijn, J. Raaijmakers, K. Buchmann, Impact of Pseudomonas H6 surfactant on all external life cycle stages of the fish parasitic ciliate Ichthyophthirius multifiliis, Journal of fish diseases 41(7) (2018) 1147-1152.
M.P. Porrini, M.C. Audisio, D.C. Sabaté, C. Ibarguren, S.K. Medici, E.G. Sarlo, P.M. Garrido, M.J. Eguaras, Effect of bacterial metabolites on microsporidian Nosema ceranae and on its host Apis mellifera, Parasitology research 107(2) (2010) 381-388.
M.R. Gillrie, L. Zbytnuik, E. McAvoy, R. Kapadia, K. Lee, C.C. Waterhouse, S.P. Davis, D.A. Muruve, P. Kubes, M. Ho, Divergent roles of Toll‐like receptor 2 in response to lipoteichoic acid and Staphylococcus aureus in vivo, European journal of immunology 40(6) (2010) 1639-1650.
B. König, U. Bergmann, W. König, Induction of inflammatory mediator release (serotonin and 12-hydroxyeicosatetraenoic acid) from human platelets by Pseudomonas aeruginosa glycolipid, Infection and immunity 60(8) (1992) 3150-3155.

No competing interests reported.

The potential role of lipopeptide biosurfactant generated by Acinetobacter junii B6 on Leishmania tropica: The synergy of lipopeptide biosurfactant and Glucantime

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Preparation of the LPBs

The Cytotoxicity Assays

Parasite Culture And Anti-promastigote Test

Anti-amastigote Assay

Evaluation Of The Expression Level Of Cytokines

Statistical analysis

Results

Cytotoxic assay

Anti-promastigote Activity

Anti-amastigote Activity

Gene Expression

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1