2.1 Animals
Sprague-Dawley (SD) rats (220–250g), provided by Sbeff Biotechnology Co., Ltd. (China), underwent hosing at 23 ± 2°C under a 12-h photoperiod, with freely available water and food. Animal experiments had approval from the Zhengzhou University Animal Care and Use Committee, following regulatory guidelines by the National Institutes of Health (NIH).
2.2 Animals Models
The whole procedure of chronic constriction injury (CCI) was based on previous research[25,26]. In brief, 4% isoflurane/oxygen was used for anesthesia induction and 2% for anesthesia maintenance. Four 5 − 0 catgut wires were utilized to loosely ligate the exposed sciatic nerve trunk in the left leg at an interval of 1 mm, which minimized the constriction of the nerve and prevented the obstruction of the epineural blood flow. Sham animals underwent the same procedure, with no sciatic nerve ligature.
2.3 siRNA Preparation
NF-κB siRNA was designed based on a published literature[27] and synthetized by GenePharma Co., LTD (Shanghai, China). The target sequences for NF-kB-specific siRNA (sense template: 5’-GGAGUACCCUGAAGCUAUAUU-3’; antisense template: 5’-UAUAGCUUCAGGGUACUCCUU-3’) have proved effective for rat PC12. The negative control siRNA (NC) was a gift from Sangon Biotech. In brief, 33 µg of NF-κB siRNA or NC siRNA was diluted in 66 µl ddH2O, to obtain 0.5 µg/µl, and stored at -20°C. Repeated freeze-thaw cycles were avoided. Methoxylated siRNA was used for in vivo injection.
2.4 Plasmid Construction and Virus Production
Briefly, rat NF-κB and Prok2 gene sequences were downloaded from the NCBI database (Supplemental Table). The target gene sequence of NF-κB underwent insertion into the EcoR V and BamH I restriction sites of the pCDNA3.1(-) vector (ThermoFisher, USA); the Prok2 gene sequence was inserted into Xho I and EcoR V restriction sites of the pGL-4.15 vector (Promega, Madison, WI) (Supplemental Table 1). Restriction mapping and DNA sequencing were utilized for construct confirmation. A short hairpin RNA (shRNA) targeting Prok2 was designed by BrainVTA Technology Co., Ltd (Wuhan, China), delivered in self-complementary AAV (scAAV) vectors. The knockdown efficiency of Prok2 in Normal Rat Kidney (NRK) cells was assessed by PCR. A mismatched shRNA with a scrambled sequence (shRNA- scrambled) was utilized as a control. Retrograde tracing viruses CTB-555 and CTB-488 were purchased from Wuhan BrainVTA Biotechnology Co., Ltd.
2.5 Stereotaxic Surgery
In this study, 4% isoflurane/oxygen was used for anesthesia induction and 2% for anesthesia maintenance in rats, whose heads were fixed by the stereotaxic apparatus. Skull measurements were based on the anterior fontanel. For NAc shell, injection area coordinates were: anteroposterior (AP), + 1.70 mm; mediolateral (ML), + 0.10 mm; dorsoventral (DV), − 7.00 mm (zeroed at the dura). The Hamilton syringe was maintained for 10 min after microinjection. The contralateral NAc underwent injection with 350 nl of scAAV-U6-shRNA (Prok2)-CMV-EGFP or scAAV-U6-shRNA (scramble)-CMV-EGFP (35 nl/min). In neuronal retrograde tracing assays, 300 nl of CTB-555 was administered by injection into the ipsilateral spinal cord (30 nl/min) as well as 300 nl of CTB-488 into the contralateral NAc (30 nl/min). For the inhibition of NF-κB, 350 nl NF-κB siRNA or NC (nonsense) siRNA was injected into the contralateral NAc (35 nl/min).
2.6 Intracerebral Catheter Implantation and NAc Microinjection
Rats were anesthetized with 2% pentobarbital sodium. A stainless-steel guide cannula was vertically inserted into rat brain 2 mm above the NAc area (AP, + 1.70 mm; ML, + 0.10 mm; DV, − 7.00 mm) after fixation of their heads on the stereotaxic apparatus, exposing the skull surface. The cannula was fixed with three microscrews and dental acrylic. After surgery, single-cage housing was performed for each rat to allow recovery for 7 days. DMSO (10%) was utilized to dissolve PDTC (200 ng/µl, P8765-1G; Sigma, USA), a selective NF-κB inhibitor; 10% DMSO was used as control solvent. Before the behavior test, a 5-µL microsyringe with a tip extending 2.0 mm beyond the guide cannula was utilized to administer drugs. The selection of drug dose was based on previous reports[28,29].
2.7 Cell Culture and Transfection
HEK-293T (Shanghai Cell Bank, China) and PC12 cells underwent culture in Dulbecco’s Modified Eagle’s Medium (DMEM; BI, Israel) containing 10% fetal bovine serum (FBS) (Gibco, USA) and 1% penicillin/streptomycin (Servicebio Company, China) at a constant temperature of 37°C with 5% CO2 for 2 to 4 days. Then, cells were collected and live cells were counted by trypan blue (Solarbio Company, China) staining. Transfection was carried out with Lipofectamine 3000 (ThermoFisher, USA) as directed by the manufacturer and following previous reports[30,31]. PC12 cells were graciously provided by the Laboratory of Histoembryology, Zhengzhou University.
2.8 Behavioral Tests
Pain and emotion-related behavioral tests were performed with the rats awake in a quiet environment. Mechanical hypersensitivity and thermal hypersensitivity were examined by paw withdrawal after stimulation with a von Frey filament and noxious thermal source, respectively. Anxiety-like behaviors were evaluated by the open field test (OFT), the elevated plus maze (EPM), and the novelty suppressed feeding test (NFST). Depression-like behaviors was evaluated by the forced swimming test (FST). All tests were carried out by observers blinded to grouping.
2.9 Paw Withdrawal Threshold
Paw withdrawal threshold (PWT) was determined as reported in a previous study[32]. Briefly, each rat was placed in a Plexiglas chamber on an elevated mesh screen for 30 minutes for 3 consecutive days before the test. According to the “up-down” method, left and right hind paws were stimulated with von Frey filaments calibrated between 1.4g and 26g (Starting with 1.4g). The force was applied perpendicularly to the plantar surface for 5s, and the interval between consecutive stimulations was at least 5 minutes. The Dixon's formula[33] was utilized for determining 50% threshold values.
2.10 Paw Withdrawal Latency
Paw withdrawal latency (PWL) was determined with a plantar analgesia device (7,370, Ugo Basile, Comerio, Italy) as described previously[32]. A cut-off time of 15s was utilized for preventing tissue injury. The final result was determined by averaging the three measurements of latency per side.
2.11 Open Field Test (OFT)
The OFT was based on previously described protocols[32], with the animals acclimated to the test room for 24 hours. At the start of the test, the rat was placed into an empty corner of a 100×100×40 cm3 box, and its behavioral features were obtained and analyzed through a centrally located video camera with Smart v.3.0 (Panlab Harvard instruments, USA) for 5 min. The number of entries into and time spent in the central area were recorded, as well as the total distance travelled. Apparatus cleaning was performed with 30% alcohol to remove odors left by the rat.
2.12 Elevated Plus-Maze (EPM) Test
The EPM test was carried out to assess anxiety-associated behaviors, as proposed previously[32]. Typically, the maze has four arms each measuring 50x10 cm2 joined by a central platform (10x10 cm2). Two close arms were enclosed with opaque black Plexiglas (40 cm high) and a pair of open arms surrounded by an edge of 1 cm high. A 5-minute adaptation was allowed before the test. A video camera located above the maze was used to record data, which were assessed with Smart v.3.0. The total distance, and the time and distance spent in open arms were recorded within 5 min.
2.13 Novelty Suppressed Feeding Test (NSFT)
The NSFT was carried out to assess anxiety-like behavior based on a previous study [34]. Rats were food-deprived for 24 h prior to the test. The test chamber was a 100×100×40 cm3 box, and rats were placed in the same corner each time. On a white square of paper, several foods were positioned centrally. The test lasted 10 min, and the endpoint was recorded with the rat’s first bite of food. The data would not be included for a rat not eating within 10 minutes. Disinfection with 30% alcohol was performed before placing the next rat into the chamber.
2.14 Forced Swimming Experiment (FST)
The FST was used to estimate the degree of depression[35]. Briefly, each rat was placed in a plastic cylinder (height, 60 cm; diameter, 20 cm) and allowed to swim for 15 minutes (pre-swimming). The cylinder was filled with clean water at 25 cm of height and kept at 22 ± 3°C. Animal immobility was reflected by floating in water with no further struggle. The test was conducted and videotaped, and immobility time was obtained for 5 minutes, with a total 6 minutes for each rat. The water in the cylinder was refreshed before each test.
2.15 Western Blot (WB)
Contralateral NAc and ipsilateral spinal cord specimens from rats were harvested on ice and underwent lysis with the RIPA buffer (#CW2333, CWBIO, China) with PMSF (#CW2200S, CWBIO) and protease phosphatase inhibitor (#CW2383S, CWBIO). After a 15-minute centrifugation at 4°C (3,000 r/min), cytosolic proteins were obtained in the supernatant. Upon measuring protein concentration by the bicinchoninic acid (BCA) method, total protein was resolved by 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis SDS-PAGE. This was followed by electro-transfer onto polyvinylidene difluoride (PVDF) membranes with 200 mA current for 90 min. After blocking with 5% FBS for 1 h, incubation was performed overnight at 4°C with rabbit anti-Prok2 (1:1000, bs-5784R, Bioss, China), rabbit anti- NF-κB (1:1000, 8242S, Cell Signaling Technology, USA), rabbit anti-NF-κB P-p65 (1:1000, ab76703, Abcam, UK), rabbit anti-IκB-α (1:1000, ab32518, Abcam), and mouse anti-GAPDH (1:5000, 60004-1-Ig, Proteintech, China). Next, the membranes underwent a 2-h incubation with goat anti-rabbit/mouse polyclonal antibodies (1:5000, SA00001-2/SA00001-1, Proteintech) at ambient. Proteins were detected with the ECL Kit (Bio-Rad), and the relative levels were quantified with the ImageJ software (NIH, USA). The analysis of the protein bands was normalized to GAPDH expression.
2.16 Reverse Transcription (RT)-PCR
Contralateral NAc and ipsilateral spinal cord specimens from sham and CCI-treated rats were harvested and snap frozen in liquid nitrogen. Total RNA extraction from the tissues utilized the TRIzol Reagent (DP419, TIANGEN Biochemical Technology; China) according to the manufacturer’s protocol. Reverse transcription was carried out with PrimeScript RT Master Mix (RR047A, TaKaRa, China). Amplification utilizing TB Premix Ex Taq (RR820A, TaKaRa) was performed on an Applied Biosystems StepOnePlus Real-Time PCR System (USA). Triplicate assays were run in 20-µL reactions. Quantitation employed GAPDH as an internal control for normalization in the ΔCT method (2−ΔΔCT). The primers used were: Prok2, sense TCATCACCGGGGCTTGCG and antisense TAACTTTCCGAGTCAGGG; GAPDH, sense ACGGCAAGTTCAACGGCACAG and antisense CGACATACTCAGCACCAGCATCAC.
2.17 Immunofluorescence (IF)
After the rat was deeply anesthetized with 2% pentobarbital, transcardiac perfusion with normal saline was performed, followed by fixation with 4% paraformaldehyde (PFA). Brain tissues were extracted and post-fixed with 4% PFA for 24 h. Subsequently, dehydration of brain tissues was carried out with 20%, 30% and 40% sucrose solutions in the following three days. NAc samples were sectioned at 20 µm with a cryostat (Leica, CM1950), washed with PBS and incubated with 5% goat serum at ambient for 1 h. This was followed by overnight (4°C) incubation with rabbit anti-Prok2 (1:200, NBP2-43853; NOVUS, USA), mouse anti- NF-κB P-p65 (1:500, sc-136548; Santa Cruz), mouse anti-NeuN (1:500, 66836; Proteintech, China), mouse anti-GFAP (1:500, 3670; Cell Signaling Technology [CST], USA), mouse anti-OX-42 (1:200, sc-53086; Santa Cruz), mouse anti-CAMKII (1:200, 50049; CST) and rabbit anti-GAD67 (1:200, ab213508; Abcam, UK). Next, goat anti-mouse Cy3-linked (1:200; Jackson ImmunoResearch, USA) and goat anti-rabbit FITC-linked (1:400, Jackson ImmunoResearch) secondary antibodies were added at 1 h at ambient. Immunofluorescence-stained images were examined under a fluorescence microscope (Olympus bx53, Japan) and a high-resolution laser confocal fluorescence microscope (Nikon A1R MP+, Japan).
2.18 Luciferase Assay
HEK293T cells plated in 12-well plates underwent culture at 37°C in a 90% humidity incubator containing 5% CO2. A day later, cell transfection was carried out with 500 ng reporter plasmids, alongside 10 ng of pRL-SV40 harboring the firefly luciferase reporter gene (Promega, USA). After 48 h of transfection, cells were collected for double fluorescence detection. Approximately 20 µL of the cell lysate supernatant was added into the detection tube or enzyme plate, followed by addition of 100 µL of Firefly Luciferase Reaction Buffer containing the substrate equilibrated to room temperature. After rapid mixing, the activity of Firefly Luciferase report gene was immediately detected with Dual-Luciferase Reporter Assay System (Promega). Assays were repeated thrice independently. Firefly activity normalization was based on Renilla activity, and the relative activity was calculated.
2.19 Statistics Analysis
Data are means ± SEM from at least three different experiments. GraphPad Prism 8.0 (GraphPad, USA) was utilized for data analysis. For in vitro experiments, cells were evenly resuspended and randomly assigned to groups; in animal experiments, the animals were randomly divided into different groups. One-way ANOVA with post hoc Tukey test and paired or unpaired Student’s t-test were utilized for variables with normal distribution such as RT-PCR, WB, IF, Luciferase assay and emotion-related behavior data. Two-way ANOVA was used for pain behavior data analysis. (*) P < 0.05 indicated statistical significance, and as high as statistically significant if P < 0.01 (**, ##) or P < 0.001 (***, ###).