Test reagents and antibodies
The following primary antibodies were used for Western blot (WB) or immunofluorescent (IF) staining as indicated below: Antibody against VE-cadherin extracellular domain (WB 1:1000, IF 1:50, R&D Systems, MAB9381), antibody against VE-cadherin intracellular domain (WB 1:1000, Santa Cruz, sc-9989), ZO-1 (WB 1:500, IF 1:50, Millipore, AB2272), α-catenin (WB 1:500, IF 1:50, Thermofisher, 71-1200), β-catenin (WB 1:1000, IF 1:50, Invitrogen, 71-2700), γ- catenin (WB 1:500, IF 1:50, Cell Signalling, 2309), rb-polyclonal VE-PTP against c-terminus (0.5 µg/ml, kindly provided by Dietmar Vestweber, Münster, Germany), cleaved caspase-3 (Asp175) antibody (WB 1:600, Cell Signaling, CatNo 9661), caspase antibody (WB 1:1000, cell signalling, CatNo 9662S), GAPDH (WB 1:5000, Sigma-Aldrich, G9295), β-actin (WB 1:3000, Sigma-Aldrich, A3854).
The following horseradish peroxidase-labeled IgG secondary antibodies were used for Western blotting: gam pox (WB 1:3000, Dianova, 115-035-003), garb pox (WB 1:3000, Dianova, 111-035-003), dam Alexa Fluor 488 (1:200, Invitrogen, A-21201), darb Alexa Fluor 488 (1:200, Invitrogen, A-21206), gam cy3 (1:600, Dianova, 115-165-003), garb cy3 (1:600, Dianova, 111-165-003).
Cloning and generation of recombinant sVE-cadherin
sVE-cadherinEC1–5 was secreted into the supernatant by CHO cells that were transfected with the pcDNA-DEST47 containing the sequence of VE-cadherin EC1-5. Cloning was performed according to manufacturer`s protocol (Gateway cloning system, Thermo Fisher Scientific, Waltham MA, USA). First, the coding sequence of EC1-5 of human VE-cadherin was amplified using cDNA from HUVEC cells as a template. The used primer pairs were designed according the Uniprot Reference for human VE-cadherin (extracellular domain) (P33151 (CADH5_HUMAN)). The Gateway Technology uses the lambda recombination system to facilitate transfer of heterologous DNA sequences (flanked by modified att sites) between vectors. Two recombination reactions constitute the basis of the Gateway Technology. The first BP reaction facilitates recombination of an attB substrate (attB-PCR product of VE-cadherin EC1-5) with an attP substrate (donor Vector: pENTR/SD-D-TOPO vector (Thermo Fisher Scientific, Waltham MA USA)) to create an attL-containing ENTRY clone. The attB PCR primer were designed according to manufacturer`s protocol (Gateway cloning system, Thermo Fisher Scientific, Waltham MA, USA). Forward primer contains Shine-Dalgarno and Kozak consensus sequence for protein expression in both E.coli and mammalian cells. (Forward primer: 5` GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CGA AGG AGA TAG AAC CAT GAT GCA GAG GCT CAT GAT GCT C 3`; Reverse primer: 5` GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC GTC AAA CTG CCC ATA CTT GAC 3´).
For the BP Recombination reaction, 10 µl of the amplified attB-PCR product, 2 µl pDONOR vector, 5 µl BP clonase reaction buffer, and 4 µl BP clonase enzyme is combined in a 1.5 ml microcentrifuge tube. After an incubation of 1 h at 25°C, 2 µl Proteinase K is added and again incubated for 1 h at 37°C. The created ENTRY clone (pENTR/SD-D-TOPO vector with VE-cadherin EC1-5 inserted) was transformed in competent E.coli cells, antibiotica selected and analyzed via colony PCR. The positive transformants containing the sequence of human VE-cadherin EC1-5 were used for the second recombination reaction, the LR reaction. The LR reaction facilitates recombination of an attL substrate (the created ENTRY clone) with an attR substrate (destination vector pcDNA-DEST 47 (Thermo Fisher Scientific, Waltham MA, USA)) to create an attB-containing expression clone. The Gateway pcDNA-DEST 47 Vector is a destination vector for cloning and exression of GFP fusion proteins in mammalian cells. Genes (VE-cadherin EC 1–5) in the created ENTRY clone are transferred to the destination vector backbone by mixing the DNAs with the Gateway LR Clonase II enzyme mix (Thermo Fisher Scientific, Waltham MA, USA). In detail: for the LR Recombination reaction, 10 µl of the created ENTRY clone, 2 µl destination vector, 4 µl 5X LR clonase reaction buffer, and 4 µl LR clonase enzyme is combined in a 1.5 ml microcentrifuge tube. The resulting recombination reaction is then transformed into E.coli and the expression clone selected. After an incubation of 1 h at 25°C, 2 µl Proteinase K is added and again incubated for 1 h at 37°C. The created destination vector (pcDNA-DEST47 vector with VE-cadherin EC1-5 inserted) was transformed in competent E.coli cells, antibiotica selected and analyzed via colony PCR. The positive transformants were used for all the following experiments.
Transfection of CHO cells
Transfection reagents were prepared as follows: Reaction mix A containing 600 µl Opti-MEM (Thermo Fisher Scientific, Waltham MA, USA; Ref.: 31985062) and 24 µl Lipofectamine LTX reagent (Thermo Fisher Scientific, Waltham MA, USA) and reaction mix B containing 700 µl Opti-MEM, 14 µl Plus reagent and 8 µg of the pcDNA-DEST47-EC1-5 plasmid were mixed and incubated for 5 minutes at room temperature. As a control for all in vitro experiments, CHO cells were transfected with pcDNA-DEST47 without the sequence of VE-cadherin EC1–5. The subsequent steps were all the same like the CHO cells transfected with the pcDNA-DEST47-EC1-5. Thereafter, CHO cells (70% confluent) at transfection day were incubated with 700 µl medium and 300 µl transfection mixture. CHO cells were obtained from ATCC (PTA 3765).
Three to four days after transfection the supernatant was taken and Halt proteinase inhibitor cocktail (Thermo Fisher Scientific, Waltham MA, USA; Ref.: 78438) was added. The supernatant was stored at 4°C until usage. The concentration of EC1-5 in the supernatants was measured using sVE-cadherin ELISA.
For control experiments cells CHO cells were transfected with the pcDNA-pDEST47 vector (without the sequence of VE-cadherinEC1–5) and supernatant was collected. This supernatant was used as control in the in vitro experiments.
Soluble VE-Cadherin Enzyme-linked immunosorbent assay (ELISA)
ELISA-based quantification of soluble VE-cadherin in cell culture supernatants (R&D Systems, Wiesbaden-Nordenstadt, Germany, DCADV0) and rat blood (MYBioSource, San Diego, USA MBS2511473) samples was performed by using VE-cadherin ELISA according to manufacturer’s instructions. As maintained by the company the antibody in this ELISA recognizes epitopes between Asp48 and Gln593 which correspond to the extracellular domain of VE-cadherin [14].
Human primary cell culture of endothelial cells
We used Human Dermal Microvascular Endothelial Cells (HDMEC; Promocell, Heidelberg, Germany) that were described previously to be a suitable model to study microvascular endothelial barrier regulation in vitro [14, 31]. Cells were used from passages 1 to 7 and grown in endothelial growth medium containing supplement mix and were passaged using Detach kit-30 (both Promocell). Culture confluency was checked by daily microscopy.
Cell Viability Assay
For measuring cell viability CellTiter-Glo® 2.0 Assay (Promega, Madison; USA; CatNo G9241), a luminescence-based cell viability assay was used. The number of viable cells in culture is determined by quantification of the amount of ATP present. The experimental set-up was designed and executed according to the manufacturer’s protocol. In brief, cells were grown on opaque-walled multiwall plates, CellTiter-Glo® 2.0 reagent was added, and luminescence signal was measured. The luminescence signal is proportional to the amount of ATP present; the amount of ATP is directly proportional to the number of viable cells present in culture. Data were normalized to the controls of each experiment [14].
Measurement of transendothelial electrical resistance (TER)
ECIS 1600R (Applied BioPhysics, Troy, NY, USA) was used to measure the transendothelial resistance (TER) of HDMEC monolayers to assess endothelial barrier integrity as described in detail previously [32]. Endothelial cells were grown to confluence on 8 well arrays (8W10E+; Applied BioPhysics, Troy, NY, USA) and were incubated with fresh medium in the presence or absence of sVE-cadherinEC1–5 as indicated below. Additionally, Y27632 and AKB9778 were added simultaneously, when combined with sVE-cadherinEC1–5 at the concentrations described above.
Permeability measurements across endothelial monolayers
HDMEC were seeded on top of transwell filter chambers on 12-well plates (0.4 µm pore size; Falcon, Heidelberg, Germany). After reaching confluence, cells were incubated with fresh medium without phenol red (Promocell, Heidelberg, Germany) containing 10 mg/mL FITC-dextran (70 kDa). Paracellular flux was assessed by taking 100 µL aliquots from the outer chamber over 2 h of incubation. Fluorescence was measured using a Tecan Microplate Reader (MTX Lab systems, Bradenton, USA) with excitation and emission at 485 and 535 nm, respectively. For all experimental conditions, permeability coefficients (PE) were calculated by the following formula as described previously [33]: PE = [(ΔCA/Δt) × VA]/S × ΔCL, where PE = diffusive permeability (cm/s), ΔCA = change of FITC-dextran concentration, Δt = change of time, VA = volume of the abluminal medium, S = surface area, and ΔCL = constant luminal concentration [34].
Immunocytochemistry
Immunostaining was performed as described previously in detail [33]. HDMECs were grown until confluence on cover slips. After incubation with mediators as indicated below fixation with 2% formaldehyde for 10 min was performed. Cells were permeabilized with PBS including 0.1% Triton X-100 (Carl Roth GmbH + Co. KG, Karlsruhe, Germany, 3051.2) for 5 min and blocked in PBS containing 3% bovine serum albumin and 1% normal goat serum (Sigma-Aldrich, Taufkirchen, Germany, A4503 & G0023) at room temperature. Primary antibodies were applied overnight at 4°C. Coverslips were washed four times in PBS and then incubated with secondary antibodies for 1 h at room temperature in present or absence of Alexa Fluor 488 phalloidin (visualization of F-actin 1:60, Invitrogen, A-12379). Coverslips were then mounted using Vectashield HardSet™ with DAPI (Vector Laboratories, Inc.; Burlingame, USA) onto slides for fluorescence microscopy and captured using ZEISS LSM 780 microscope (Carl Zeiss AG, Oberkochen, Germany) and ZEN 3.4 software. Quantification of the images was performed as described previously [35].
Western Blotting
Cells growing on 6-well plates were scrapped after adding SDS lysis buffer. Lysates in Laemmli buffer were separated by SDS-PAGE and transferred onto nitrocellulose membranes by wet blotting. Blocking was carried out in 5% low fat milk in Tris-buffered saline Tween-20 (TBST). The membranes were incubated with the appropriate primary antibodies overnight at 4°C. Horseradish peroxidase labelled secondary antibodies were incubated for 1 h at room temperature. Proteins were visualized by the enhanced chemiluminescence technique (ECL, Amersham, Munich, Germany) and developed using ChemiDoc™ Imaging System (BioRad, Feldkirchen, Germany).
Rho activity assay
For measurements of active RhoGTPase in cells, RhoA G17 agarose beads (Abcam, Cambridge, UK) were used according to manufacturer´s recommendations. Confluent HDMEC monolayers were lysed and incubated with the agarose beads, incubated for 2h at 4°C. After centrifugation and washing with RIPA buffer, the beads were resuspended in SDS-PAGE sample buffer and boiled for 5 min. The precipitated Rho-GEF was then detected by western blotting using GEF-H1 antibody (abcam, Cambridge, UK, Cat No ab155785). As an internal loading control, untreated equivalent aliquots of confluent HDMEC cells were harvested and western blot using GEF-H1 antibody was performed.
Atomic force microscopy (AFM) measurements with recombinant VE-cadherin-Fc
AFM measurements were conducted on an atomic force microscope (Nanovizard III, JPK Instruments, Berlin, Germany) mounted on an inverted microscope (IX83, Olympus, Tokyo, Japan). AFM cantilevers (MLCT, Bruker, Calle Tecate, USA) and mica sheets (SPI supplies, West Chester, USA) were functionalized with recombinant VE-cadherin-Fc as outlined earlier [21]. Force-distance curves (FDC) were recorded with an applied force of 0.3 nN, a contact delay of 0.1 s and a retraction velocity of 1 µm/s. For each individual experiment, 1000 FDC were recorded in HBSS to assert baseline VE-cadherin trans-interaction. Thereafter, the mica and cantilever were incubated for 1h with 130 ng/ml sVE-CadEC1–5 and 1000 additional FDC were recorded on the same position on the mica sheet. JPKSPM Data Processing software (JPK Instruments) was used to analyze recorded FDC and to determine VE-cadherin binding events. The resulting binding probability is the ratio of FDC that showed a VE-cadherin interaction and the total number of FDC.
RNA extraction and sequencing
RNA from HDMEC was isolated using TRIZOL. RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7.7. DNA libraries suitable for sequencing were prepared from 300 ng of total RNA for four samples and appx 200 ng for two samples with lower concentrations, with oligo-dT capture beads for poly-A-mRNA enrichment using the TruSeq Stranded mRNA Library Preparation Kit (Illumina) according to manufacturer’s instructions (½ volume). After 15 cycles of PCR amplification, the size distribution of the barcoded DNA libraries was estimated ~ 325 bp by electrophoresis on Agilent DNA 1000 Bioanalyzer microfluidic chips. Sequencing of pooled libraries, spiked with 1% PhiX control library, was performed at 25 million reads/sample in single-end mode with 75 nt read length on the NextSeq 500 platform (Illumina) using High output sequencing kit. Demultiplexed FASTQ files were generated with bcl2fastq2 v2.20.0.422 (Illumina).
To assure high sequence quality, Illumina reads were quality- and adapter-trimmed via Cutadapt (Martin, 2011) version 2.5 using a cutoff Phred score of 20 in NextSeq mode, and reads without any remaining bases were discarded (command line parameters: --nextseq-trim = 20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC). Processed reads were subsequently mapped to the human genome (GRCh38.p19) using STAR v2.7.2b with default parameters [36]. Read counts on exon level summarized for each gene were generated using featureCounts v1.6.4 from the Subread package [37]. Multi-mapping and multi-overlapping reads were counted strand-specific and reversely stranded with a fractional count for each alignment and overlapping feature (command line parameters: -s 2 -t exon -M -O --fraction). The count output was utilized to identify differentially expressed genes using DESeq2 [38] version 1.24.0. Read counts were normalized by DESeq2 and fold-change shrinkage was applied by setting the parameter “betaPrior = TRUE”. Differential expression of genes was assumed at an adjusted p-value (padj) after Benjamini-Hochberg correction < 0.05 and |log2FoldChange| ≥ 1.
The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus [39] and are accessible through GEO Series accession number GSE210502: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE210502.
Purification of sVE-cadherinEC1–5 supernatant
For all in vivo experiments the supernatant of the sVE producing CHO cells were concentrated 10 times via Vivaspin Turbo 15 (4°C, 4000xg). Afterwards the purification was carried out by 60% ammoniumsulfat precipitation. This was done overnight at 4°C on a shaker. After overnight incubation the precipitated protein solution was centrifuged 15 min at 15000 g. The protein was resuspended in NaCl and the dialysis with a 1 kDa molecular weight cut off membrane took two days with several NaCl buffer changes.
Experimental set-up of in vivo experiments
Experiments were performed on Sprague-Dawley rats (n = 20; aged 5–7 weeks, 200–250 g; Janvier, 53940 Le Genest Saint Isle, France). Animals were kept under conditions that conformed to the National Institutes of Health “Guide for the Care and Use of Laboratory Animals”. All rats were maintained on a standard diet and water ad libitium for 12 h day and night cycles. Animals were not fasted prior to the procedure.
We combined established experimental set-ups to allow continuous measurements of microcirculatory flow and capillary leakage using intravital microscopy as well as the simultaneous assessment of macrohaemodynamic parameters to test the effects of sVE-cadherin in vivo [4, 40–42].
Prior to 0.8–1.5% (v/v) isofluorane anesthesia (Forene Abbott, Wiesbaden Germany), 0.2 mg/kg BW butorphanol was injected subcutanously. To apply i.v. medication, the right jugular vein was cannulated. Additionally, the left carotid artery was cannulated for continuous blood pressure and heart rate measurements (Hewlett-PackardModel 88S, Hamburg, Germany). Tracheotomy was performed and rats were mechanically ventilated with FiO2 0.28 using a rodent ventilator (Type: 7025, Hugo Sachs Elektronic KG, March-Hugstetten, Germany) in a constant ventilation regime. Animals’ body temperature was always kept at 37◦C using a heating plate. Sufficient depth of anaesthesia under the latter conditions had been tested in preliminary experiments and by estimation of heart rates, mean arterial pressure (MAP), leg movement in response to painful stimuli (which was possible because muscle relaxants were not applied) and eye-lid closing reflex.
Thereafter, median laparotomy was performed, and the mesentery was gently taken out and spread over a pillar as has been described elsewhere [4]. The whole experimental set-up was then carefully placed under a modified inverted Zeiss microscope (Axiovert 200, Carl Zeiss, Göttingen, Germany) equipped with different lenses (Achroplan ×10 NA 0.25/×20 NA0.4/×40 NA 0.6). This allowed continuous observation of microcirculatory flow within postcapillary venules in the mesenteric windows as well as observation of capillary leakage following i.v. injection of FITC-albumin at 5 mg/100 g BW as described below. Images and videos were captured using a digital camera, ColorSnap CF (Photometrics, Tucson, USA), driven by Metamorph analysis software (Molecular Devices GmbH, Biberach a.d. Riss, Germany) and digitally recorded for off-line analysis as described below. In the time course of experiments the upper surface of the mesentery was continuously superperfused with 37.5◦C crystalloid solution (Sterofundin, B. Braun Melsung AG, Melsung, Germany).
Randomization of animals into experimental groups
After the preparation procedure animals were allowed to recover for 30 min and then samples for the first blood gas analyses (baseline samples) were taken using an ABL505 blood gas analyser (Radiometer, Copenhagen, Denmark). Each collected amount of blood was replaced by an equal volume of 0.9% sodium chloride (Fresenius Kabi, Bad Homburg, Germany). Before randomization of animals into different groups, the following criteria for exclusion were applied: MAP < 60 mmHg, blood loss with Hb < 7 g/dl, pH < 6.9 or heart rate > 550 bpm during preparation procedures. After baseline analyses of blood gas samples and haemodynamic parameters, rats were randomized into experimental groups. One group was used as control group (n = 5), in one group (n = 5) 130ng/ml sVE-cadherinEC1–5 adapted to the calculated blood volume/BW administered i.v. and one group received 130 ng/ml sVE-cadherinEC1–5 1 h preincubated with VE-PTP inhibitor AKB 9778 (n = 5) 0.6 mg per injection subcutaneously as described previously [13]. An additional control group received 2.5 mg/kg BW LPS from Escherichia coli (Sigma, L2630; Deisenhofen, Germany) (n = 10) to induce systemic inflammation [4].
Intravital measurement of microvascular permeability
To assess changes of microvascular permeability during the experimental procedures, digital fluorescence images were taken after single i.v. injection of FITC-albumin 5 mg/100 g BW (Sigma, Deisenhofen, Germany). Fluorescence images were taken using a 100 W mercury lamp and a filter set consisting of a 450–490 nm excitation and a 520 nm emission filter within an inverted microscope (Zeiss Axiovert 200, Carl Zeiss, Göttingen, Germany). Images were taken before randomization, 15 min and 30 min (endpoint) after injection of either NaCl, sVE-cadherinEC1–5 or LPS or sVE-cadherinEC1–5 + AKB9778. Microvascular permeability was then estimated by determining the extravasation of FITC-albumin by measurements of integrated optical intensity as described previously [43]. The labelled FITC-albumin represented relative changes in permeability: ΔI = 1−(Ii − Io)/Ii, where ΔI is the change in light intensity, Ii is the light intensity inside the vessel, and Io is the light intensity outside the vessel. Grey scale values were measured in the postcapillary venules and in the extravascular space around the venules per unit area throughout the experiments and at selected times using ImageJ software. For each time point 10 randomly selected intravascular and interstititial areas near the postcapillary venules were selected for the measurements by a blinded observer.
Evaluation of microcirculatory flow
Analysis of microvascular blood flow was carried out in straight segments of venular microvessels (20–35 µm in diameter). Velocity of erythrocytes was measured by a blinded investigator using the software VisiView (Puchheim, Germany). For each time point the velocities of 27 randomly chosen erythrocytes within postcapillary venules were measured for each animal. For each time point six to nine vessels per animal were analysed.
Histopathological analyses of lungs
Lungs were removed after experimental procedures for histopathological studies. The tissues were fixed in formaldehyde 3.5% (Otto Fischar, Germany) for more than 24 h. Tissues were then embedded in paraffin and subsequently, sections were stained with H&E for analyses of morphological alterations within the tissues as described previously [4]. BZ-II Analyzer Software was used to measure thickness of alveolar septa. In each of the animals, three sections were analysed and in each section thickness of 15 randomly chosen alveolar septa were measured by a blinded observer.
Modelling of sVE-cadherin interaction with VE-PTP
3D structures of VE-PTP and VE-Cadherin were extracted from Alphafold databank respectively with P23467 and P33151 cods. Easy version of HADDDOCK online server was used to assess the potential interaction between sVE-cadherin (5th domain) and the 17th domain of VE-PTP. Amino acids with a surface area which exposed to water were more than 40%, were considered as active amino acids. After molecular docking, the output data were divided and the classes were rated based on Z-score. After performing molecular docking and selecting the best complex, the complex was used to do molecular dynamics simulation. To simulate molecular dynamics, the protonation state of ionisable atoms such as aspartate, glutamate, lysine, arginine and histidine at pH7 was first determined using Propka software. Gromacs 2021.5 software was used to simulate molecular dynamics and amber99SB + ILDN force field was used to parameterize the protein. The protein molecule was then placed inside an octagonal box and the distance of the protein from the walls of the box is 0.8 nm. The TIP3P water model added to the box as the solvent. And 4 sodium ions were replaced with water molecules to neutralize the system. The energy of the system was then minimized in 50,000 steps. The steepest descend algorithm was used for minimization. The system temperature then equilibrated to 300 K on the NVT stage for 200 ppm. V-rescale algorithm was used to balance the temperature at this stage. Then, in the NPT stage, the system was stabilized on one Bar pressure with the Parrinello-Rahman algorithm for 200 ps. In the mentioned equilibration steps, heavy protein atoms with a force of 1000 kJ / m2 were kept constant (kJ / mol nm2). In the final stage (production), the simulation was continued under NPT for 100 ns. The time step in all stages of the simulation is 2 fs. The LINCS algorithm was also used to keep the length of covalent bonds (other than hydrogen bonds with heavy atoms) constant. In the production stage, the Nose-Hoover algorithm was used to keep the temperature constant.
Statistical analysis
Statistical analysis was performed using Prism (GraphPad Software, La Jolla, CA, USA). Data are presented as means ± SEM. Statistical significance was assumed for p < 0.05. Paired Student’s t-test was performed for two-sample group analysis after checking for a Gaussian distribution. Analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test and Bonferroni correction was used for multiple sample groups. For non-parametric data, Kruskal–Wallis following Dunn’s post- test or Mann–Whitney U-test were used for significant differences. The tests applied for each of the different experiments are indicated in the figure legends.