Expression of Interleukin 1, Interleukin 27 and TNF α Genes in Patients with Ischemic Cardiomyopathy Versus Idiopathic Dilated Cardiomyopathy

doi:10.21203/rs.3.rs-233343/v1

Download PDF

Research Article

Expression of Interleukin 1, Interleukin 27 and TNF α Genes in Patients with Ischemic Cardiomyopathy Versus Idiopathic Dilated Cardiomyopathy

https://doi.org/10.21203/rs.3.rs-233343/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective: Congestive Heart failure (CHF) is a complex multifactorial syndrome due to tissue hypo perfusion that is affected by some factors like inflammatory cytokines. In our study we investigated the exact gene expression of three inflammatory cytokines in ischemic and idiopathic cardiomyopathy patients.

Materials and Methods: From 49 studied recipients in ischemic group, 23 (46.9%) were male and from 40 studied recipients in idiopathic dilated cardiomyopathy group, 19 (47.5%) were male. For the quantitative analysis of Interleukin (IL)1, IL-27 and TNF-α mRNAs expression level, the SYBR Green Real-Time PCR method was performed using SYBRPremix Ex TaqTM II (Tli RNaseH Plus) (Takara, Japan) and designed primers speciﬁc for each genes in an iQ5 thermocycler (BioRad Laboratories, USA) according to the manufacturer’s instructions.

Results: Our results showed that the expression level of IL-1 and TNF-α were significantly higher in the ischemic patients compared to healthy controls (P<0.001, P<0.01, respectively); also we found higher levels of IL-1 and IL-27 gene expressions in idiopathic patients compared to healthy controls (P<0.001, P<0.001, respectively). There were not any significant difference of IL-1, IL-27 and TNF-α expression levels between ischemic patients and idiopathic ones.

Conclusion: Although we would introduce IL1, IL-27 and TNF α as effective inflammatory cytokines on myocardial functions in ischemic and idiopathic cardiomyopathy patients; there is not any difference between these two groups in gene expression of three main inflammatory cytokines.

Cardiac & Cardiovascular Systems

interleukin

congestive heart failure

ischemic cardiomyopathy

idiopathic dilated Cardiomyopathy

Congestive Heart failure (CHF) is a complex multifactorial syndrome due to tissue hypo perfusion and body fluid retention that is presented by fatigue, cachexia, shortness of breath and inability to do some ordinary daily activities[1]. The most common cause of CHF is ischemic insults to myocardium (myocardial infarction) while other probable reasons such hypertension, alcohol usage, viral infection and muscle abnormalities occurred by genetic defects should not be forgotten[2]. Notwithstanding of previous studies on this chronic syndrome, there is a major question that which pathogenesis is responsible for left ventricular failure and cardiomyopathy in absence of ischemic events of myocardium[3] .About one third of CHF patients suffered from dilated cardiomyopathy (DCM). Cardiomyopathy is a condition of deterioration of myocardial function and structure that is finally leads to heart failure. In dilated ones patients suffered from dilatation of one or both ventricle size with reduction of ejection fraction. If primary and secondary etiologies excluded, dilated cardiomyopathy is considered as idiopathic (IDCM). In another word, it is defined as non-ischemic cardiomyopathy with depressed left ventricular (LV) function[4] .Cardiomyopathy also is the most common cause of heart transplantation in CHF patients [5, 6]. Not only increasing in inflammatory cytokines but also overexpression of immunological antigens is seen in cardiomyopathy patients; [3] besides that, complex impaction of inflammatory and pro-inflammatory cytokines on CHF progression not well understood [7, 8]. Two major pathways of immune activation in these patients are explained in literature: the first one is direct antigenic stimulation and the second one is immune activation secondary to cardiac injury. The last one exposes the heart to bad immune response and triggers the patients` condition [9].Tumor Necrosis Factor alpha (TNFα) almost is the most effective pro-inflammatory cytokine in HF patients that is not present in normal myocardium. Failed myocardium produces TNF α to blood stream but its` receptor is down regulated in inflammatory process of heart failure [10]. In animal models, systemic administration of TNF α induces dilated cardiomyopathy phenotype in mouse's myocardium [11]. Also blockade of biological effect of TNFα in humans has been shown to improve myocardial function and degree of disease severity in some surveys [12, 13].

Another cytokine that has a big role in inflammatory pathogenesis of HF is interleukin 1 (IL1) [14] .Many studies emphasize on deleterious effects of IL1 on infarction and remodeling of the heart [15]. This cytokine has an important impaction on modulating myocardial function and is increased in HF patients; [16] but according to some challengeable studies, concentrations of IL 1 in IDCM patients might not be elevated rather than control group [17]. In some other researches, an effective role of IL1 has been explained that could facilitate the immigration of macrophages and monocytes into tissues in inflammatory conditions [18]. Also administration of IL1 receptor antagonists has been revealed to be a therapeutic strategy in treating inflammatory and autoimmune conditions [19]. Another survey showed elevated levels of IL1 β mRNA in IDCM patients in a comparative study [20].As a matter of fact, autoimmunity is known as a pathogenic agent in IDCM patients [21]. In another hand, raised inflammatory cytokines is not only present in IDCM but also is seen in ischemic cardiomyopathy patents [22].Serum levels of inflammatory cytokines and their correlation with disease severity and patients` prognosis in IDCM versus ischemic CMP patients is not still well understood. Therefor, we conducted this study in order to determine the exact expression of TNFα, IL 1 and IL 27 (as a new probable effective cytokine in inflammatory processes) genes in these two groups and will compare them to each other and control group.

In this case-control study we enrolled a total number of 89 non-diabetic patients, with known DCM with NYHA (New York Heart Association) class II and III who were referred to cardiology department affiliated to Namazee hospital, Shiraz, Iran between March 2016 and February 2019. The patients participated in our study were DCM ones that were diagnosed more than 3 months before the study and received optimal medical therapy according to medical guidelines and had no history of hospitalization. Of these patients, 49 were diagnosed as ischemic ones evidenced by coronary angiography consist of advanced three-vessel coronary artery disease or thrombosis-induced transmural myocardial infarction and forty patients were included in idiopathic DCM group after ruling out the possible causes by means of history, transthoracic echocardiography and coronary angiography. Also, we enrolled 49 age and sex adjusted healthy non-diabetic controls without any disease to compare with these two groups. All patients underwent two-dimensional echocardiography using a vivid E9 system (GE, Norway) and all measurements were performed according to the latest recommendations of American Society of Echocardiography [22] .The left ventricular end-diastolic volume (LVEDV) and left ventricular ejection fraction (LVEF) was calculated based on Simpson’s biplane method. For homogenous sampling, the LVEDV index exceeding 100 mL/m2 and LVEF between 20-35% were considered as inclusion criteria as previously described in similar performance [15]. The present methodology met all the rules contributed to Helsinki protocol. This study was approved by the institutional review board of Shiraz University of Medical Sciences and won the approval of the Ethical Committee (IR.SUMS.MED.REC9045.39.01.93). All the experimental methods programed in the present study were in accordance with confirmed setups used in previous studies.

Sample collection and ribonucleic acid isolation

Five-milliliter peripheral blood was collected in Ethylenediaminetetraacetic acid (EDTA)-containing tubes from each patient at the time of diagnosis prior to chemotherapy treatment and also healthy individuals. The peripheral blood mononuclear cells (PBMCs) were isolated from each patient and controls using Ficoll-hypaque density gradient centrifugation. Total RNA was extracted by TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions and guidelines as previously described briefly [15, 23, 24].

SYBR green real-time polymerase chain reaction

For the quantitative analysis of IL 1, IL27 and TNF mRNAs expression level, the SYBR Green Real-Time PCR method was performed using SYBRPremix Ex TaqTM II (Tli RNaseH Plus) (Takara, Japan) and designed primers speciﬁc for each genes in an iQ5 thermocycler (BioRad Laboratories, USA) according to the manufacturer’s instructions as previously described briefly [15,23, 24].

Statistical analysis

Data were analyzed by Statistical Package for Social Sciences (SPSS) software, version 18. The differences in the mean expression level of IL 1, IL 27 and TNF-α before and after chemotherapy as well as patients according to the comparison of NYHA class, LVEF and LVEDVI between patients with idiopathic and ischemic dilated cardiomyopathy which were compared independent t test. Also, the mean expression level of IL 1, IL 27 and TNF-α regarding laboratory data was analyzed by the Chi-square test.

From 49 studied recipients in ischemic group, 23 (46.9%) were male and from 40 studied patients in idiopathic dilated cardiomyopathy group, 19 (47.5%) were male. The mean age of patients was 52 ± 1.6 ranged from 20–67 years and the mean age of the control group was 48 ± 3.5 ranged 19–84 years. Table 1 shows the primers and thermocycling condition for the IL-1, IL-27, TNF-α and GAPDH Transcripts.

Table 1

The Primers and thermocycling condition for the IL-1, IL-27, TNF-α and GAPDH Transcripts
Gene	Primer sequences (5'->3')	PCR Product length	Thermocycling condition
IL-1: F IL-1: R	CTTCAGCCAATCTTCATT CACTGTAATAAGCCATCAT	88bp	95 ͦ C/2 min, 40 cycles of 95°C/30 sec, 60°C/20 sec and 70°C/30 sec
IL-27: F IL-27: R TNF-α:F TNF-α:R	CAGGCTCTACCCAGTAAC AATAAACCATCATCTCCCTAAAC CAACCTCTTCTGGCTCAA TGGTGGTCTTGTTGCTTA	94 bp 80bp	95 ͦ C/2 min, 40 cycles of 95°C/30 sec, 57°C/20 sec and 70°C/30 sec 95 ͦ C/2 min, 40 cycles of 95°C/30 sec, 58°C/20 sec and 70°C/30 sec
GAPDH:F GAPDH:R	GGACTCATGACCACAGTCCA CCAGTAGAGGCAGGGATGAT	119bp	95 ͦ C/2 min, 40 cycles of 95°C/30 sec, 57.5°C/20 sec and 70°C/30 sec

Table 2 displays the baseline characteristics of ischemic and IDCM patients that there were not any significant differences of demographic data of two groups. The functional status and echocardiographic findings of patients with DCM are also summarized in Table 3. We found that LVEF and LVEDVI were higher in ischemic DCM patients compared to IDCM individuals but it was not significant (p value = 0.07 and 0.11, respectively). Indeed, there was no any difference between stages of NYHA class in two groups.

Table 2

Baseline characteristics of ischemic and idiopathic cardiomyopathy patients
Characteristics	Ischemic DCM (n = 49)	Idiopathic DCM (n = 40)	P
Age (y)	53.21 ± 6.2	51.3 ± 9.5	0.22
BMI (kg/m2)	26.7 ± 3.2	24.3 ± 1.4	0.431
Gender (Male/n, %)	23 (46.9%)	19 (47.5%)	0.758
Risk factors
Smoking	11 (22.4%)	8(20.0%)	0.651
LDL-C > 130 mg/dL (n, %)	7(14.2%)	5(12.5%)	0.901
TG > 150 mg/dL (n, %)	10 (20.4%)	7(17.5%)	0.574
HDL-C < 40 in men or < 50 in women (n, %)	4(8.1)	3 (7.5%)	0.105
Hypertension	9 (18.3%)	8 (20.0%)	0.13

Table 3

The comparison of NYHA class, LVEF and LVEDVI between patients with idiopathic and ischemic dilated cardiomyopathy
Variable	Idiopathic DCM, n = 49	Ischemic DCM, n = 40	P value
NYHA class (n, %)	16 (32.6%)	16 (40.0%)	0.50
LVEF (%)	26.8 ± 4.07	31.57 ± 6.21	0.07
LVEDVI (mL/m2)	143.29 ± 29.1	135.25 ± 39.4	0.11
Data was expressed as mean ± SD or numbers. DCM: dilated cardiomyopathy, NYHA: New York Heart Association, LVEF: left ventricular ejection fraction, LVEDVI: left ventricular end-diastolic volume index.

IL-1, IL-27 and TNF-α gene expression in Ischemic patients and controls

The mRNA expression analysis of IL-1, IL-27 and TNF-α gene measured as Ct (cycle threshold) and ∆Ct values. Our results showed that the expression level of IL-1 and TNF-α were significantly higher in the ischemic patients compared to healthy controls (P < 0.001, P < 0.01, respectively). However, no significant difference was observed between IL-27 in the Ischemic patients compared to healthy controls.

IL-1, IL-27 and TNF-α gene expression in Idiopathic patients and controls

After the statistical analysis, our results revealed that the expression level of IL-1 and IL-27 were significantly higher in the idiopathic patients compared to healthy controls (P < 0.001, P < 0.001, respectively). However, no significant difference was observed between TNF-α in the idiopathic patients compared to healthy controls.

IL-1, IL-27 and TNF-α gene expression in Ischemic patients and Idiopathic (Left) patients

Our results demonstrated that the expression level of IL-1, IL-27 and TNF-α were not significantly higher in the idiopathic patients compared to ischemic ones.

In our study we investigated the exact gene expression of three inflammatory cytokine in CHF patients. So, we found that IL-1 and TNFα were higher in ischemic DCM patients than controls and gene expression of IL-1 and IL-27 also were higher in IDCM than control group; while there was no any significant differences of TNF α between these two groups.

TNFα and IL-1 are two cytokines with negative inotropic effects on the myocardium by uncoupling β-adrenergic signaling; [25] they have a big role on myocardial remodeling and hypertrophy after myocardial infarction [26]. Notwithstanding many previous researches on CHF, this fact that myocardial insults provoke inflammatory cytokines activity or inflammatory system deteriorate the condition of patients by activating direct antigenic pathways and immune system, is remained as a puzzle [9]. Van Tassell and his colleagues in an experimental study showed that overexpression of IL-1 gene in systolic heart failure patients can lead to poor exercise tolerance. They did their study to discover any new approach to treatment of heart failure patients and finally proposed IL-1β blockade as a novel treatment for future success approaches in treatment of these patients [27]. Also in another study, anakinra as a IL-1 blockade agent was used to reduce systemic inflammatory response in acute decompensated HF patients and finally their results supported their hypothesis [28]. In consistent with these, Kang YM et al. observed significant increasing of brain pro-inflammatory cytokines (IL-1) in ischemic induced heart failure rats [29]. In another hand, researchers examined whether the blockade of TNF α as a new neurohormonal pathway could be effective in treatment of HF patients or not. Finally they found out that this blockade is a well-established way to improve functional status and myocardial functions [12]. Interleukin 27 as a novel member of IL-12 group cytokines is high in patients with coronary artery disease [30, 31] but it`s exact function in ischemic insults to myocardium is unclear. Ming-Chieh Ma et al. in an experimental study showed it`s cardio protective effects in ischemic events of rat` hearts [31]. Unlike this finding, Tetsuaki Hirase and his coworkers investigated the immunoregulation of macrophages in mice by lacking IL-27 and its receptor so finally concluded that IL-27 plays an inhibitory role in atherosclerosis with adjustment the activation of macrophages in mice [32]. In our study we found that IL-27 is significantly higher in IDCM patients than control group while this correlation was not significant between ischemic DCM ones and controls.

It is believed that myocardial ischemic insults enforce myocardium to produce TNF α and inflammatory process is known to has a significant correlation with coronary atherosclerotic events in CHF patients. In a big database trial, Vesnarinone Trial (VEST), Deswal et al. concluded that the most important inflammatory cytokines such as TNFα and interleukin 6 have more gene expression in ischemic DCM than idiopathic DCM patients [33]. Another study that supports lower expression of TNF-α and IL-1 genes in IDCM patients is Bironaite study [17]. But we did not find any significant differences of any cytokine between ischemic DCM patients and IDCM ones. In a similar study that was carried out by Iravani Saadi et al. they compared IL-6 and IL-18 as two effective inflammatory cytokines between ischemic DCM and IDCM. They found that these two cytokine have higher expression in IDCM and ischemic ones than control group [15] but in the same line of our study, they did not find any significant difference between IDCM and ischemic DCM patients compared to each other. According to these findings we can produce IL-27 as a novel inflammatory cytokine in HF patients particularly in ischemic DCM ones. Moreover, it is hopeful to describe new pathways of therapy guidelines in HF patients as a complex syndrome with complex treatments.

HF patients due to ischemic insults after myocardial infarctions were more frequent than idiopathic ones. Our small sample size due to exclusion of decompensated patients was one of our shortages and limitations of this study. Also, we suggest enrolment of all stages of heart failure patients and evaluation of any stages correlations with expression of different cytokines for future studies.

In our study we found that there were not any significant differences of inflammatory cytokines (TNFα, IL-1 and IL-27) between ischemic DCM and IDCM patients. IL-27 as a newly introduced cytokine was higher in IDCM patients than controls. TNFα was not significantly higher in IDCM than controls. Additionaly, IL-27 did not have higher expression in ischemic DCM patients than controls but some surveys have been introduced it as an effective factor on myocardial functions in ischemic/reperfusion events. According to these antitheses in our results and other researches and importance of the matter, further studies are recommended in future.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Shiraz University of Medical Sciences and all patients signed a predefined written inform consent before entering the trial.

Availability of Data and Materials

The datasets generated and/or analysed during the current study are not publicly available due internal ethical policies (sample bank of cardiomyopathy patients available in "Muhammad Rasoololah Research Tower affiliated with Shiraz University Of Medical Sciences") and privacy maintenance of patients` data but are available from the corresponding author on reasonable request.

Consent for publication

Not applicable

Competing interests

All authors declare no competing financial interests exist.

Funding

This study was financially supported by Shiraz University of Medical Sciences.

Authors' contributions

MIS, JS, HA, EA, MAB & AM set up the study design and interpreted the data. AM, ZK & AN performed the statistical analyses, interpreted the data and drafted the manuscript. AM, HA & AM revised the manuscript critically and provided continuous guidance throughout the study. All authors read and approved the final manuscript.

Acknowledgements

The author would like to thank Shiraz University of Medical Science, also the Hematology Research Center. Also, it is necessary to give all the best to all patients who participated in the study.

Cohn JN. The management of chronic heart failure. New England Journal of Medicine 1996,335(7):490-498 %@ 0028-4793.
Thackray S, Easthaugh J, Freemantle N, Cleland JG. The effectiveness and relative effectiveness of intravenous inotropic drugs acting through the adrenergic pathway in patients with heart failure—a meta‐regression analysis. European Journal of Heart Failure 2002,4(4):515-529.
Braunwald E. Biomarkers in heart failure. New England Journal of Medicine 2008,358(20):2148-2159.
Lang RM. Chamber Quantification Writing Group; American Society of Echocardiography's Guidelines and Standards Committee; European Association of Echocardiography. Recommendations for chamber quantification: a report from the American Society of Echocardiography's guidelines and standards committee and the chamber quantification writing group, developed in conjunction with the European Association of Echocardiography, a branch of the European Society of Cardiology. J Am Soc Echocardiogr 2005,18:1440-1463.
Cooper Jr LT. Myocarditis. New England Journal of Medicine 2009,360(15):1526-1538.
Wexler R, Elton T, Pleister A, Feldman D. Cardiomyopathy: an overview. American family physician 2009,79(9):778.
Mann DL. Targeted anticytokine therapy and the failing heart. The American journal of cardiology 2005,95(11):9-16.
Aukrust P, Yndestad A, Damås JK, Gullestad L. Therapeutic potential of anticytokine therapy in congestive heart failure. American Journal of Cardiovascular Drugs 2004,4(3):169-177.
Torre-Amione G. Immune activation in chronic heart failure. The American journal of cardiology 2005,95(11):3-8.
Torre-Amione G, Kapadia S, Lee J, Bies RD, Lebovitz R, Mann DL. Expression and functional significance of tumor necrosis factor receptors in human myocardium. Circulation 1995,92(6):1487-1493.
Bozkurt B, Kribbs SB, Clubb Jr FJ, et al. Pathophysiologically relevant concentrations of tumor necrosis factor-α promote progressive left ventricular dysfunction and remodeling in rats. Circulation 1998,97(14):1382-1391.
Bozkurt B, Torre-Amione G, Warren MS, et al. Results of targeted anti–tumor necrosis factor therapy with etanercept (ENBREL) in patients with advanced heart failure. Circulation 2001,103(8):1044-1047.
Sattin M, Towheed T. The Effect of TNFα-Inhibitors on Cardiovascular Events in Patients with Rheumatoid Arthritis: An Updated Systematic Review of the Literature. Current rheumatology reviews 2016,12(3):208-222.
Van Tassell BW, Canada J, Carbone S, et al. Interleukin-1 blockade in recently decompensated systolic heart failure: results from REDHART (Recently Decompensated Heart Failure Anakinra Response Trial). Circulation: Heart Failure 2017,10(11):e004373.
Saadi MI, Beigi MAB, Ghavipishe M, et al. The circulating level of interleukins 6 and 18 in ischemic and idiopathic dilated cardiomyopathy. Journal of cardiovascular and thoracic research 2019,11(2):132.
Van Tassell BW, Raleigh JMV, Abbate A. Targeting interleukin-1 in heart failure and inflammatory heart disease. Current heart failure reports 2015,12(1):33-41.
Bironaite D, Daunoravicius D, Bogomolovas J, et al. Molecular mechanisms behind progressing chronic inflammatory dilated cardiomyopathy. BMC cardiovascular disorders 2015,15(1):26.
Dinarello CA, Pomerantz BJ. Proinflammatory cytokines in heart disease. Blood purification 2001,19(3):314-321.
Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 1996,87(6):2095-2147.
Vanderheyden M, Paulus W, Voss M, et al. Myocardial cytokine gene expression is higher in aortic stenosis than in idiopathic dilated cardiomyopathy. Heart 2005,91(7):926-931.
Calabrese F, Thiene G. Myocarditis and inflammatory cardiomyopathy: microbiological and molecular biological aspects. Cardiovascular research 2003,60(1):11-25.
Aukrust P, Ueland T, Lien E, et al. Cytokine network in congestive heart failure secondary to ischemic or idiopathic dilated cardiomyopathy. The American journal of cardiology 1999,83(3):376-382.
Iravani Saadi M, Arandi N, Yaghobi R, Azarpira N, Geramizadeh B, Ramzi M. Aberrant Expression of the miR-181b/miR-222 after Hematopoietic Stem Cell Transplantation in Patients with Acute Myeloid Leukemia. Indian journal of hematology & blood transfusion : an official journal of Indian Society of Hematology and Blood Transfusion 2019,35(3):446-450.
SAADI MI, Arandi N, Yaghobi R, Azarpira N, Geramizadeh B, Ramzi M. Up-Regulation of the miR-92a and miR-181a in Patients with Acute Myeloid Leukemia and their Inhibition with Locked Nucleic acid (LNA)-antimiRNA; Introducing c-Kit as a New Target Gene. International Journal of Hematology and Oncology,28(3):001-009.
Feldman A. Combes A, Wagner D, Kadakomi T, Kubota T, Li YY, and McTiernan C. The role of tumor necrosis factor in the pathophysiology of heart failure J Am Coll Cardiol 2000,35:537-544.
Kleinbongard P, Heusch G, Schulz R. TNFα in atherosclerosis, myocardial ischemia/reperfusion and heart failure. Pharmacology & therapeutics 2010,127(3):295-314.
Van Tassell BW, Arena RA, Toldo S, et al. Enhanced interleukin-1 activity contributes to exercise intolerance in patients with systolic heart failure. PloS one 2012,7(3):e33438.
Van Tassell BW, Abouzaki NA, Erdle CO, et al. Interleukin-1 blockade in acute decompensated heart failure: a randomized, double-blinded, placebo-controlled pilot study. Journal of cardiovascular pharmacology 2016,67(6):544.
Kang Y-M, Zhang Z-H, Xue B, Weiss RM, Felder RB. Inhibition of brain proinflammatory cytokine synthesis reduces hypothalamic excitation in rats with ischemia-induced heart failure. American Journal of Physiology-Heart and Circulatory Physiology 2008,295(1):H227-H236.
Jafarzadeh A, Nemati M, Rezayati M. Serum levels of interleukin (IL)-27 in patients with ischemic heart disease. Cytokine 2011,56(2):153-156.
Ma M-C, Wang B-W, Yeh T-P, et al. Interleukin-27, a novel cytokine induced by ischemia–reperfusion injury in rat hearts, mediates cardioprotective effects via the gp130/STAT3 pathway. Basic research in cardiology 2015,110(3):22.
Hirase T, Hara H, Miyazaki Y, et al. Interleukin 27 inhibits atherosclerosis via immunoregulation of macrophages in mice. American Journal of Physiology-Heart and Circulatory Physiology 2013,305(3):H420-H429.
Deswal A, Petersen NJ, Feldman AM, Young JB, White BG, Mann DL. Cytokines and cytokine receptors in advanced heart failure: an analysis of the cytokine database from the Vesnarinone trial (VEST). Circulation 2001,103(16):2055-2059.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Expression of Interleukin 1, Interleukin 27 and TNF α Genes in Patients with Ischemic Cardiomyopathy Versus Idiopathic Dilated Cardiomyopathy

Status:

Version 1

Abstract

Introduction

Materials And Methods

Sample collection and ribonucleic acid isolation

SYBR green real-time polymerase chain reaction

Statistical analysis

Results

IL-1, IL-27 and TNF-α gene expression in Ischemic patients and controls

IL-1, IL-27 and TNF-α gene expression in Idiopathic patients and controls

IL-1, IL-27 and TNF-α gene expression in Ischemic patients and Idiopathic (Left) patients

Discussion

Limitations

Conclusion

Declarations

Ethics approval and consent to participate

Availability of Data and Materials

Consent for publication

Competing interests

Funding

Authors' contributions

Acknowledgements

References

Additional Declarations

Status:

Version 1