2.1 Isolation and purification of exosomes derived from BMSCs
BMSCs were a kind gift from the Research Institute of Suzhou University. When the BMSC fusion degree reached 80–90%, the culture medium was removed. The cells were washed three times with phosphate-buffered saline (PBS, Meilunbio, China), starved, and cultured in medium (DMEM, MULTICELL, China) with/without 100 ng/mL LPS (L2880, Sigma, USA) but without serum, and the supernatant was collected after 24 h.
Density gradient ultracentrifugation was used to isolate BMSCs-derived exosomes (Exo) and LPS-pretreated BMSC-derived exosomes (L-Exo). The specific experimental procedure is as follows. The cells in the supernatant (300 g, 10 min), the cell fragments (2000 g, 20 min), and the apoptotic bodies were removed (10000 g, 30 min) by centrifugation. Then, the eccentric supernatant was discarded after two times of ultracentrifugation (both centrifugation parameters were 100000 g, 70 min). Finally, the exosome suspension was clarified by re-centrifugation with PBS, and the exosome suspension was stored at − 80°C for follow-up experiments.
2.2 Particle size analysis
After the calibration test of the Nanometer particle analyzer (N30E, NanoFCM, China), the exosomes with appropriate concentrations were selected for sampling. After the detection was completed, the particle size of the exosome was saved and recorded.
2.3 Transmission electron microscope (TEM)
A volume of 10 mL exocrine suspension was dropped on the copper net, precipitated for 1 min, and then the floating liquid was absorbed with filter paper. Subsequently, 10 mL uranyl acetate was absorbed and dropped on the copper net, precipitated for 1 min; the supernatant was absorbed, and then air-dried at room temperature. At 100 kV, the electron microscope (Hitachi, Japan) was adjusted to a suitable observation magnification, and the imaging results were recorded by TEM.
2.4 Raw264.7 cells co-cultured with Exo and L-Exo
Raw264.7 cells were a kind gift from the Research Institute of Suzhou University. After incubating and adhering overnight with DMEM medium containing 10% fetal bovine serum and 100 U/mL streptomycin-penicillin, 10 mg/mL exosomes were added to co-culture for 20 h, and then fresh medium containing 100 mg/mL LPS was replaced for 20 h. Finally, the cells and the culture supernatant were collected.
2.5 Western blot (WB)
The protein concentration of various exosomes was detected using BCA (EC0001, SparkJade, China). The cellular protein (10µg/lane) extract was separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (EMD Micropore). Then, the membrane was blocked with 5% skimmed milk at 25 ℃ for 1 h, probed overnight with the primary antibody (CD9 (ab92726, Abcam, UK), CD63 (A5271, Abclonal, USA), Tsg101 (ab125011, Abcam, UK), CCN3 (MAB1976, R&D, USA), TNF-a (4ab080637(s), 4A BIOTECH, China), iNOS (Ab283655, Abcam), GAPDH (Proteintech, USA)) at 4 ℃, and then incubated with goat anti-rabbit secondary antibody (SA00001-2, Proteintech, USA) at 25 ℃ for 1 h. Finally, the immunoreactive bands were developed with TBST using a hypersensitive chemiluminescence detection kit (S6009M,Suzhou Youyi Randy Biotechnology, China).
2.6 Quantitative reverse transcription real-time polymerase chain reaction (RT-qPCR)
Total mRNA was extracted from cells using an RNA extraction kit (TaKaRa, Japan). The gene was reverse transcribed using a gene synthesis kit (Vazyme). SYBR qPCR Mix Kit (SparkJade) was used for RT-qPCR amplification (pre-denaturation: 94°C for 3 min, followed by 39 PCR reaction cycles. The reaction conditions were as follows: denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s). Fluorescence quantitative PCR (Bole CFX96) was used for detection and analysis. The primer sequences of mRNAs are listed in Table 1, and the relative expression level of mRNAs is determined according to the 2−∆∆Ct method.
Table 1
| Gene | Primer sequence (5’–3’) |
| TNF-α | F: GAACTGGCAGAAGAGGCACT |
| R: CATAGAACTGATGAGAGGGAGG |
| iNOS | F: GCTGTTCTCAGCCCAACAAT |
| R: GGCCTTGTGGTGAAGAGTGT |
| CD86 | F: TGGACCCCAGATGCACCAT |
| R: TAGGTTTCGGGTGACCTTGC |
| CD206 | F: CTGCAGATGGGTGGGTTATT |
| R: GGCATTGATGCTGCTGTTATG |
| NOTCH1 | F: TGACAACTCCTACCTCTGCTTATG |
| R: GGTTCACAGGCACATTCGTA |
| CCN3 | F: GCGAATTCGAAGTATACCTCGAGGCCACCATGAGCCTCTTCCTGCGAA |
| R: CGATCGCAGATCCTTGGATCCTTAAATTTCTCCTCTGCTTGTCTTCA |
2.7 Cell count kit-8 (CCK-8)
The cell viability was detected using the CCK-8 kit (Dojindo, Japan), according to the manufacturer’s instructions. RAW264.7 cells were seeded in a 96-well plate at a density of 1×104 cells/well. After 24 h of culture, the fresh medium containing 10 mg/mL exosome suspension was changed at different time periods. After the exosomes were co-incubated with RAW264.7 cells for different time points, the co-culture was incubated in fresh medium containing 100 ng/mL LPS for 24 h, followed by co-culture with 10 mL CCK-8 solution in each well for 4 h. Then, the absorbance was measured at 450 nm on an enzyme labeling instrument (SpectraMaxiD3, USA).
2.8 Enzyme-linked immunosorbent assay (ELISA)
The supernatant of the cell culture was collected and stored at − 20 ℃ for subsequent cytokine analysis. The concentration of TNF-α was detected using a Mouse TNF-α ELISA kit (DKW1217102, China) according to the manufacturer’s instructions.
2.9 Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)
Raw264.7 cells were plated in a 6-well plate at a density of 2×104 cells/well for 24 h. Then, fresh medium containing 10 mg/mL L-Exo/Exo suspension was replaced for 20 h, followed by fresh medium containing 100 ng/mL LPS for 20 h. Apoptosis was detected by TUNEL detection kit (Biyuntian) and laser confocal microscope (LSM800, Zeiss) according to the manufacturer’s instructions. Briefly, the cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min, and washed with PBS, stained with the TUNEL detection reagent in the dark at 37°C. Finally, the film was sealed with anti-fluorescence quenching and examined under a fluorescence microscope.
2.10 Mass spectrometry analysis
The exosomes were cleaved, and the protein in the solution was precipitated by acetone, digested with enzyme, desalted, and marked according to the instructions of the TMT kit (Thermo, USA). Then, the labeled samples were mixed in the same amount, desalted, and vacuum-dried. Then, the samples were graded, separated, and merged into 15 components by high pH reverse-phase chromatography (Thermo, USA). After vacuum drying, the samples were frozen at − 80 ℃ for use. LC-MS/MS data were acquired on an Orbitrap Exploris 480 mass spectrometer coupled with an Easy-nLC 1200 system. Peptides were loaded through an autosampler and separated on a C18 analytical column (75 mm × 25 cm, C18, 1.9 mm, 100 Å). Mobile phase A (0.1% formic acid) and mobile phase B (80% ACN, 0.1% formic acid) were used to establish the separation gradient. A constant flow rate was set at 300 nL/min. For DDA mode analysis, each scan cycle consisted of one full-scan mass spectrum (R = 60 K, AGC = 300%, max IT = 20 ms, scan range = 350–1500 m/z), followed by 20 MS/MS events (R = 15 K, AGC = 100%, max IT = auto, cycle time = 2 s, TurboTMT enabled). HCD collision energy was set to 35. The isolation window for precursor selection was set to 1.2 Da. The former target ion exclusion was set for 35 s. MS raw data were analyzed with MaxQuant (V1.6.6) using the Andromeda database search algorithm. The spectra files were searched against the UniProt Human proteome database using the following parameters: TMT mode was checked for quantification; variable modifications, oxidation (M), acetyl (Protein N-term), and deamidation (NQ); Fixed modifications, carbamidomethyl (C); digestion, trypsin/P; the MS1 match tolerance was set as 20 ppm for the first search and 4.5 ppm for the main search; the MS2 tolerance was set as 20 ppm. The search results were filtered with 1% false discovery rate (FDR) at both protein and peptide levels. Proteins denoted as decoy hits, contaminants, or only identified by sites were removed, and the remaining targets were used for further quantification analysis.
2.11 Construction of lentivirus overexpressing/interfering with CCN3 protein and infecting BMSCs
The mouse CCN3 gene sequence amplified by PCR and the designed and synthesized shRNA sequence were inserted into PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-Puro and pGMLV-SC5 RNAi expression vectors, respectively (shRNA oligo sequences are shown in Table 2). The transfection system consisting of 850 mL DMEM, 10 mg plasmid, 10 mL Lenti-HG Mix (Genomeditech/GMLCP), and 60 mg HG transgene reagent (Health Gene/TG-10012) was co-transfected into HEK293T cells (donated by the Research Institute of Suzhou University), and the virus was packaged and amplified. BMSCs were infected by recombinant lentivirus, and the green fluorescence intensity was observed by fluorescence microscope. The overexpression and silencing efficiency of CCN3 was detected by WB.
Table 2
| Oligo naming | Oligomeric single-stranded DNA sequence (5’–3’) |
| Primer-T1 | GATCCGCACTAGCTTGTACACCTATACTCGAGTATAGGTGTACAAGCTAGTGCTTTTTT |
| Primer-B1 | AATTAAAAAAGCACTAGCTTGTACACCTATACTCGAGTATAGGTGTACAAGCTAGTGCG |
| Primer-T2 | GATCCGGGAGAGTTGTTCTGAGATGACTCGAGTCATCTCAGAACAACTCTCCCTTTTTT |
| Primer-B2 | AATTAAAAAAGGGAGAGTTGTTCTGAGATGACTCGAGTCATCTCAGAACAACTCTCCCG |
| Primer-T3 | GATCCGCTTGGCCCTTCCAGCCTATACTCGAGTATAGGCTGGAAGGGCCAAGCTTTTTT |
| Primer-B3 | AATTAAAAAAGCTTGGCCCTTCCAGCCTATACTCGAGTATAGGCTGGAAGGGCCAAGCG |