Cell culture and small interfering RNA transfection
BV2 microglial cells were seeded in 6-well plates with appropriate density (1.0 × 10^6/well) before transfection, which were maintained in humidified incubators at 37 °C in a 5% CO2 incubator for about 24 h. In the RNA interfering test, siRNA and shRNA, assigned by Genephrama, Shanghai, China, were transfected with lipofactamine 3000 for 24 h. LPS (O111:B4, Sigma, USA) solution was diluted in cell culture medium (DMEM) before added into wells containing cells for 4 h or 12 h before collection. Sequences of the IRF5 siRNA, the non-targeting scramble siRNA and shRNA sequences used in this study were as follows.
IRF5: siRNA-1 sense sequence: 5’-GCAGUUUAAAGAGCUUCAUUU-3’
antisense sequence: 5’-AUGAAGCUCUUUAAACUGCUU-3’
siRNA-2 sense sequence: 5’-GCCUAGAGCAGUUUCUCAAUU-3'
antisense sequence: 5’-UUGAGAAACUGCUCUAGGCUU-3’
Scramble siRNA: sense sequence: 5’-GUUAGAAAGGGCAGAUAAAUU-3’
antisense sequence: 5’-UUUAUCUGCCCUUUCUAACUU-3’
shRNA sequence: GATCCCCGCCTAGAGCAGTTTCTCAATGCGAACATTGAGAAACTGCT
Animals
C57/BL6 mice were obtained from SLAC laboratory animal company (Shanghai, China). They were housed on a 12 h light/dark cycle with room temperature at 22 °C, and had ad libitum access to food and water. All procedures were approved by the Institutional Animal Care and Use Committee of Zhejiang University and conducted in accordance with the National Institutes of Health guide for the care and use of laboratory animals (NIH Publication No. 85 − 23, revised 1996) guidelines for ethical treatment of animals.
Intracerebroventricular (ICV) Injection Of siRNA And LPS
Eleven-week-old male mice were anesthetized with intraperitoneal administration of Avertin (1.25%, 20 µl/g of body weight, Sigma, loss of toe pad reflexes), and then fixed on a stereotaxic instrument (RWD, Shenzhen, China) in a flat position. The bregma coordinates used for injection were − 1.0 mm lateral, -0.3 mm posterior and − 2.5 mm below. SiRNA (IRF5 or scramble) with transfection reagent (4 µl) was injected, followed by injection of LPS (O111:B4, 2 mg/ml, 2 µl) or normal saline (NS) 24 h later. Mice were sacrificed 4 h or 24 h after LPS injection.
Western Blot
Brain tissues including cortex and hippocampus were homogenized in homogenization buffer with protease inhibitors containing 50 mM Tris-HCl (pH 7.4), 2 mM EDTA, 2 mM EGTA, 2 mM Na3VO4, 50 mM NaF, 20 mM β-glycerophosphate, 0.5 mM AEBSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 4 µg/ml pepstatin A. BV2 microglial cells were lysed on ice with RIPA lysis buffer (Thermo Fisher Scientific, USA). Protein was separated by gel electrophoresis and transferred to PVDF membranes (Millipore, Bedford, MA, USA). Membranes were blocked with 5% skim milk in 0.1% Tris-buffered saline/Tween-20 (TBST) for 1 h, and then incubated with primary antibody IRF5 (1:500, Abcam) overnight at 4℃. After incubation with the appropriate HRP-conjugated secondary antibody for 1 h at room temperature, the membranes were detected by the ECL-PLUS system (ECL, Pierce, and Rockford, USA). The signal intensity was analyzed with Image Lab (BIO-RAD, Hercules, CA).
Immunofluorescence
Mice were anesthetized by intraperitoneal injection of Avertin (0.02 ml/g) and perfused transcardially with ice-cold 4% paraformaldehyde (PFA)/PBS. The brains were fixed with 4% PFA for 2 h, followed by cryoprotection in 30% sucrose for 24 h at 4℃. Coronal sections were cut immediately after embedding. Following incubation overnight at 4℃ with primary antibodies, rat anti-CD11b (1:500, AbDSerotec) and, rabbit anti-IRF5 (1:500, Abcam), brain sections were incubated with secondary antibodies conjugated to Alexa Fluor 488 or Cy3 (1:1000, Thermo Fisher). The sections were then mounted on microscope slides after dying with DAPI (1:10000, Sigma, USA) for 10 min. For every 10 sections, one section was selected and analyzed using Nikon A1 confocal microscopy (Nikon, Japan).
Quantitative real-time PCR
Total RNA was isolated with TRIZO (invitrogen, Canada). First-strand cDNA was synthesized from total RNA by using 5x PrimeScript RT master mix (Takara, Japan). Secondary reacting step was real-time PCR using TB Green Premix Ex TaqⅡ(Takara, Japan) with StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Gene primers for quantitative PCR below were designed from National Center for Biotechnology Information database.
IRF5: 5’-CAGGTGAACAGCTGCCAGTA-3’ (forward)
5’-GGCCTTGAAGATGGTGTTGT-3’ (reverse)
GAPDH: 5’-GTGTTCCTACCCCCAATGTGT-3’ (forward)
5’-ATTGTCATACCAGGAAATGAGCTT-3’ (reverse)
Enzyme-linked Immunosorbent Assay (ELISA)
Frozen tissue was homogenized in ice-cold buffer as mentioned above. The homogenates were diluted 1:5 before ELISA was carried out. TNF-α, IL-1β and IL-6 were subsequently measured using ELISA kits (ABclonal, China) according to the manufacturer’s instructions. Three replicate wells were set up for each sample.
Statistical Analysis
Data are presented as mean ± SEM, and differences among groups were determined with GraphPad Prism Version 7 by one-way ANOVA, followed by the Bonferroni post hoc test. PCR data were expressed as 2^(-ΔΔCT). P < 0.05 was considered statistically significant.