Suppressors of cytokine signalling (SOCS1) inhibits neuroinflammation by regulating TLR4 and ROS in BV2 cells

doi:10.21203/rs.3.rs-2346227/v1

Download PDF

Research Article

Suppressors of cytokine signalling (SOCS1) inhibits neuroinflammation by regulating TLR4 and ROS in BV2 cells

https://doi.org/10.21203/rs.3.rs-2346227/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

The Suppressors of cytokine signalling(SOCS) proteins are physiological suppressors of cytokine signaling which have been identified as a negative feedback loop to weaken cytokine signaling. However, the underlying molecular mechanisms is unknown. This study was to investigate the role of SOCS1 in the oxygen-glucose deprivation and reoxygenation (OGDR) or LPS induced inflammation in microglia cell line BV-2 cells.

Materials and methods

BV-2 microglial cells were used to construct inflammation model. A SOCS1 over-expression plasmid was constructed, and the SOCS1 deficient cells were generated by utilizing the CRISPR/CAS9 system. BV-2 microglial cells were pretreated with over-expression plasmid or SOCS1 CRISPR plasmid before OGDR and LPS stimulation. The effect of SOCS1 on proinflammatory cytokines, toll-like receptor4 (TLR4), and reactive oxygen species (ROS) were evaluated.

Results

We found that SOCS1 increased in OGDR or LPS treated BV-2 microglial cells in vitro. SOCS1 over-expression significantly reduced the production of proinflammatory cytokines including tumor necrosis factor α (TNF-α), interleukin 1β (IL-1β), and IL-6, and CRISPR/CAS9-mediated SOCS1 knockout reversed this effect. Also we determined that SOCS1 over-expression reduced the level of reactive oxygen species (ROS) while the absence of SOCS1 increased the production of ROS after OGDR or LPS stimulated inflammation. Furthermore, we found that OGDR and LPS induced the expression of toll-like receptor 4 (TLR4) in BV2 cells. Nevertheless, SOCS1 over-expression attenuated the expression of TLR4, while knockdown of SOCS1 upregulated TLR4.

Conclusions

Our study indicated that SOCS1 played a protective role under inflammatory conditions in OGDR or LPS treated BV-2 cells through regulating ROS and TLR4. These data demonstrated that SOCS1 served as a potential therapeutic target to alleviate inflammation after ischemic stroke.

Oxygen-glucose deprivation and reoxygenation (OGDR)

inflammation suppressor of cytokine signaling 1(SOCS1)

lipopolysaccharide (LPS)

reactive oxygen species(ROS)

toll-like receptor 4 (TLR4)

Ischemic stroke is a main cerebrovascular disease that threatens human health and life with a high ratio of disability, morbidity and mortality [1]. It happens when there is insufficient blood supply to the brain for normal function, resulting in irreversible neuronal apoptosis and hypoxic brain injury [2]. The brain responds to ischemic injury with acute and systemic inflammatory processes that are characterized by the rapid activation of resident cells, mainly microglia, the production of inflammatory mediators such as nitric oxide (NO), proinflammatory cytokines, and infiltration of various inflammatory cells including neutrophils, different subtypes of T cells and monocyto/macrophages [3]. Previous studies demonstrated that inhibition of inflammatory processes could reduce the infarct size and improve the neurological function in ischemic stroke [4]. Therefore, controlling microglia mediated inflammatory responses is needed for the therapy of ischemic stroke.

The suppressor of cytokine signaling (SOCS) protein family produces important regulators of cytokine-mediated signaling in multiple tissue types [5]. which is composed of at least eight protein members: SOCS1-7 and cytokine-induced SH-2 protein (CIS) [6]. Among SOCS proteins, CIS, SOCS1, and SOCS3 proteins can be considered the third immune-checkpoint molecules since they regulate cytokine signals that control the polarization of CD4 + T cells and the maturation of CD8 + T cells [7, 8]. SOCS1 acts as a negative feedback loop to weaken signaling via the JAK2/STAT3, NF-κB, and TLR4 pathways [9], which are critical to the transmission of cytokine signals from the cell surface to the nucleus [10, 11]. In the central nervous system, SOCS1 regulates neuronal damage and neuronal immunity [12].

At the cellular level, multiple origins of ROS production have been documented [13]. Initially, ROS generation was considered as the byproduct of different biological processes. However, accumulated evidence showed that ROS participated in various cellular signaling events, such as NF-κB-regulated inflammatory responses in different cell types, particularly in immune cells [14–16]. Studies have observed that during the ROS-mediated apoptosis of immue cells SOCS1 expression was induced by ROS, and SOCS1 over-expression led to the inhibition of oxidant-induced apoptosis. As a mechanism to inhibit ROS signaling, SOCS1 protected protein tyrosine phosphatases(PTP) from inactivation by ROS attack [17].

Toll like receptors (TLRs) are pivotal players in the induction and regulation of immune/inflammatory responses [18]. TLR4 can unleash strong regulatory effects on post-ischemic inflammatory responses by activating the transcriptional factors NF-κB [19, 20]. The activation of NF-κB can induce the excessive generation of inflammatory mediators, such as tumor necrosis factor-α (TNF -α), interleukin − 1β (IL-1β) and interleukin-6 (IL-6) [21], while the inhibition of TLR4/NF-κB inflammatory pathway can exert strong protective effects on middle cerebral artery occlusion (MCAO) in rats [22]. Therefore, the regulation of microglia activation and the associated TLR4/NF-κB inflammatory pathway may be essential to the pathological processes in the central nervous system and could serve as potential therapeutic targets for ischemic stroke [23]. However, the mechanisms that regulate TLR4 expression in ischemic stroke are still uncertain.

Recently, several reports have demonstrated that IFNAR signaling induces SOCS1-mediated ubiquitination and degradation of active Rac1. Reduction of active Rac1 decreased the production of mitochondrial reactive oxygen species (ROS) [10]. However, the ability of SOCS1 to blunt ischemic stroke-induced oxidative stress has not yet been investigated. So we focus on the function of SOCS1 after OGDR and LPS-induced inflammation and find some relevant key mediators, such as ROS and TLR4. Moreover, we investigated the inhibitory effect of SOCS1 over-expression on OGDR- and LPS-induced inflammation.

2.1. Cell culture and transfection

BV-2 cells were obtained from the Neurobiology Laboratory of Xuzhou Medical University, and cultured in DMEM/H-G supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/L streptomycin, at 37˚C in a 5% CO₂ incubator. Cells were plated into a six-well plate (Corning, Corning, NY, USA) at a density of 3.5 × 10⁵ cells/well 24 h prior to transfection. The cell confluence was ensured to reach 70–90% at transfection. BV-2 cells were transfected with a SOCS1 over-expressed plasmid, empty plasmid or CRISPR SOCS1 plasmid using PEI for 24h, after which transfection efficiency was determined using western blot analysis.

For OGDR experiment, BV2 cells were randomly divided into the following groups: (1) normal control group (control group); (2) SOCS1 plasmid group; (3) empty plasmid + OGDR group; (4) SOCS1 plasmid + OGDR group; (5) CRISPR SOCS1 plasmid; (6) CRISPR SOCS1 + OGDR group; (7) empty plamid group. Cells were washed twice with PBS, placed in glucose-free DMEM, and then exposed to hypoxia (94%N₂/5%CO₂/1%O₂) at 37˚C in a humidified chamber (Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 2h. Then, oxygen-glucose deprivation was terminated and reoxygenation started by exposing the cells to normal culture conditions (37˚C, 5% CO₂) for 6h.

For LPS stimulation, The BV-2 cells were then randomly divided into the following groups: (1) normal control group (control group); (2) SOCS1 plasmid group; (3) empty plasmid + LPS group; (4) SOCS1 plasmid + LPS group; (5) CRISPR SOCS1 plasmid; (6) CRISPR SOCS1 + LPS group; (7) empty plamid group. BV2 cells were treated with LPS (from Escherichia coli. O111:B4, Sigma-Aldrich) at 1000ng/ml or vehicle for 24h.

2.2. RNA extraction and qRT-PCR

Total RNA was extracted using the TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the instructions. The concentration of isolated RNA was measured using the optical densities at 260 and 280 nm. RNA reverse transcription was carried out using a commercially available cDNA Synthesis Kit (Molecular Devices, Sunnyvale, CA, USA). QPCR was performed using qPCR SYBR Green Master Mix (Vazyme, Nanjing, China). Quantitative real time polymerase chain reaction (qRT-PCR) was performed on an ABI 7900 system (Applied Biosystems, Foster City, CA). Relative gene expression was calculated using the 2^−△△Ct method. The primer sequences used for these studies were listed as follows:

SOCS1Forward: 5’-ACTGCTAGCATGGTAGCACGCAACCAGGTGGC-3’

SOCS1Reverse: 5’-ACTGGTACCGATCTGGAAGGGGAAGGAAC-3’

18s RNA forward: 5’-TTGACTCAACACGGGAACC-3’

18s RNA reverse: 5’-AGACAAATCGCTCCACCAAC-3’

2.3. Preparation and identification of the PCDNA SOCS1 plasmid

The eukaryolic expression vector of pEGFP-N3 was purchased from Genentech. Polymerase chain reaction (PCR) was implemented to amplify the SOCS1 fragment (~ 900bp) from cDNA. T4 DNA ligase was used to connect the double-enzyme vector, which was detached by endonucleases Hindll and Xhol and the hSOCS1 fragment (the endonucleases and T4 DNA ligase were purchased from NEB Company, Beijing, China). Products obtained after connection were transformed into DH5 alpha competent cells through the thermal stimulation method. After collection of the monclones, positive clones were identified by RT-qPCR and then amplified and cultured. Plasmid was extracted by a plasmid extraction kit and sent for sequencing and pair analysis. Clones with right sequences indicated successful construction of objective plasmids. The PCR primers for plasmid preparation and identification were listed as follows:

SOCS1 forward: ACTGCTAGCATGGTAGCACGCAACCAGGTGGC;

SOCS1 reverse: ACTGGTACCGATCTGGAAGGGGAAGGAAC.

The bold base sequences were enzyme sequences. Xhol: 5’C/TCGAG3’ Hindll: 5’GTY/RAC3’

2.4. CRISPR/CAS9-induced knock-out of SOCS1

Genome editing was achieved by transduction of the CRISPR/CAS9 system. In order to construct plasmids for CRISPR-mediated silencing of SOCS1, the PX330 vector was used as a backbone. The vector was digested using BSMBI, and hybridized oligos were cloned into the single guide RNA (sgRNA) scaffold. The oligos were designed based on the target site sequence contained on the 3’-end a 3bp PAM sequence (NGG). sgRNA sequences used in the study were:

gSOCS1-F1: CACCGACAATGCGATCTCCCCGGCA

gSOCS1-R1: AAACTGCCGGGGAGATCGCATTGT

The vector contained ampicillin was used as a selectable marker gene. An empty plasmid was used as the control.

2.5. Western blot analysis

Total protein was extracted from cortical brain tissues 6h, 1, 3, and 5 days after MCAO, and the BV2 cells 3, 6 and 12h after OGDR treatment. Considering the most obvious change, the optimal times of 3 days in vivo and 6 h in vitro were chosen for subsequent research. The expressions in SOCS1, IL-1β, IL-6, and TNF-α were assessed by Western blotting analysis as previously described [24]. Briefly, protein samples were prepared and loaded onto 10% SDS-PAGE gels, and then the proteins were transferred to NC membranes (Millipore, Billerica, MA, USA). After being blocked by 5% nonfat dry milk, the membranes were incubated overnight with the following primary antibodies, SOCS1 (1:1000 dilutions; CST), IL-6 (1:1000 dilutions; CST), IL-1β (1:200 dilutions; Santa Cruz), TNF-α (1:1000 dilutions; Abcam), and GAPDH(1:10,000, Abcam). Anti-rabbit IgG and anti-mice IgG (1:2,000; Santa Cruz, Waltham, MA, USA) were used as the secondary antibodies. Immunoreactive proteins were observed using western blotting detection reagents (Cell Signaling Technology, Danvers, MA, USA).

2.6. Detection of intracellular ROS

BV-2 cells were cultured in a 96-well plate and treated with SOCS1 plasmid or CRISPR SOCS1 plasmid before OGDR exposure. A Reactive Oxygen Species Assay kit was purchased from Sigma-Aldrich and used according to the manufacturer’s instructions. The treated cells were washed three times with PBS and then incubated in 10 mM DCFH-DA (Sigma, St. Louis, MO, USA) for 30 min at 37˚C in dark. After washing twice with PBS, images were acquired by fluorescence microscopy (Olympus, Tokyo, Japan). The relative quantification of intracellular ROS intensity was obtained using Image J software.

2.7. Statistical analysis

All data were represented as mean ± SD. The unpaired two-tailed student’s t-test was used for experiments comparing two sets of data. Among multiple groups, one-way ANOVA was used to test statistical significance of difference. The statistical package for the social sciences 16.0(spss Inc., Chicago, IL, USA) and Graphpad Prism V 6.0 (Graphpad software Inc.) software were used for all statistical analysis. P-value of < 0.05 were considered to be statistically significant.

3.1. SOCS1 increased in the OGDR and LPS treated BV2 cells in vitro.

To figure out whether SOCS1 was involved in the process of ischemic brain injury, western blot analysis was performed using the proteins extracted from OGD treated BV2 cells. Figure 1 showed that the expression of SOCS1 increased in OGD/R or LPS induced BV2 cells in vitro. Figure 1b-c showed that the level of SOCS1 was higher in BV2 cells treated with OGD for 0.5, 1, 2, and 3h, compared with control group (n = 3/group, *p < 0.05 vs control group). Figure 1d-e showed that level of SOCS1 was higher in BV2 cells after OGDR exposure for 3, 6, 12h compared with control group and 2h OGD (n = 3/group, *p < 0.05 vs control group, ^#P < 0.05 vs 2h OGD). We constructed another inflammatory model with LPS stimulation. As shown in Fig. 1f-g, compared with control group, the level of SOCS1 was increased at 3h, 6h, 12h, and 24h (n = 3/group, *p < 0.05 vs control group). In summary, In vitro, the optimal time for SOCS1 was 2h for OGD exposure, and the optimal reoxygenation time was 6h after 2h OGD. The optimal time was 24h after LPS stimulation. The above times were chosen for subsequent experiments.

3.2. Oxygen glucose deprivation/reoxygenation and LPS induced the release of pro-inflammatory cytokines in BV-2 cells.

To investigate the level of pro-inflammatory cytokines IL-1β, IL-6, TNF-α, and iNOS in OGDR and LPS induced iflammation. First, we checked the effects of OGDR on cellular inflammation in BV2 cells. The levels of various pro-inflammatory cytokines were evaluated by western blotting. As shown in Fig. 2a-b, protein levels of IL-1β, IL-6, TNF-α, and iNOS increased in OGDR-induced BV2 cells, compared to control group (n = 3, *p < 0.05 vs control group). Similarly, in the LPS stimulation model (Fig. 2c-d), levels of pro-inflammatory cytokines, IL-1β, IL-6 and TNF-α, also increased compared with control group (n = 3, *p < 0.05 vs. control group).

3.3. SOCS1 protein over-expression inhibited production of pro-inflammatory cytokines in BV2 microglial cells after OGDR or LPS stimulation.

To investigate whether SOCS1 regulates the pro-inflammatory cytokines in in vitro model of OGDR, BV-2 cells were transfected with either an empty vector or SOCS1 plasmid, and then treated with OGDR for 6h followed by measurement of the protein levels of IL-1β, IL-6, TNF-α. We assessed protein levels of various markers for inflammation by western blotting. The SOCS1 plasmid was used to enhance endogenous SOCS1 expression (Fig. 3b-c). Next, we examined the protein levels of inflammatory cytokines. As shown in Fig. 3d-e, compared to the control group, SOCS1 over-expression significantly decreased the protein levels of IL-1β, IL-6, TNF-α in OGDR-induced cells. Then, after stimulation of LPS, BV-2 cells were transfected with a SOCS1 over expression plasmid. The expression of IL-1β, IL-6, and TNF-α were detected by western blotting (Fig. 3f-g). The result showed that over expression of SOCS1 in BV2 cells significantly inhibited the increases of IL-1β, IL-6 and TNF-α induced by LPS stimulation.

3.4. CRISPR/CAS9-mediated SOCS1 knock-out increased OGDR or LPS induced production of pro-inflammatory cytokines in BV2 cells

To further precisely evaluate the molecular function of SOCS1 to regulate IL-1β, IL-6, and TNF-α, we generated SOCS1-deficient cells by utilizing the CRISPR/CAS9 system. Once CAS9 was recruited to the target sites by the guide RNA, CAS9 produced double-strand DNA breaks. Insertions and deletions of nucleotides during DNA repair frequently cause frameshift mutations, leading to the early termination of protein synthesis. Therefore, we constructed a plasmid for the CRISPR-mediated silencing of SOCS1, named CRISPR-SOCS1. Deficiency of SOCS1 mediated by the plasmid was confirmed by western blot analysis (Fig. 4b-c). The CRISPR-GFP construct, in which the GFP sequence was targeted, was used as an empty plasmid. To explore the impact of SOCS1 under inflammatory conditions, BV-2 cells were transfected with CRISPR-SOCS1 for 24h and then exposed to OGDR. We assigned the cells into four groups: control, CRISPR group, empty plasmid + OGDR, CRISPR SOCS1 + OGDR group. To this end, we measured the expression level of pro-inflammatory cytokines (Fig. 4d-e). Notably, western blot data showed that the signal intensities of IL-6, IL-1β, TNF-α were much higher in SOCS1-deficient cells than in the empty plasmid group after OGDR exposure. In particular, the pro-inflammatory IL-6 was significantly upregulated under SOCS1-silencing condition. Simultaneously (Fig. 4d-e), we repeated the afore mentioned experiment using the LPS inflammation model, and found that the deficiency of SOCS1 increased the production of IL-6, IL-1β or TNF-α. These data suggested that SOCS1 deficiency probably exacerbates inflammation progression (Fig. 4f-g).

3.5. SOCS1 regulates OGDR or LPS induced inflammation through ROS pathway

SOCS1 plays a vital role in protection against oxidative stress. Therefore, we hypothesized that SOCS1 suppresses OGDR-induced ROS production. To confirm this hypothesis, BV2 cells were transfected with SOCS1 over-expression and CRISPR SOCS1 plasmids, and then stimulated with OGDR. The production of ROS was measured using a DCFH-DA fluorescence probe. Figure 5a showed that OGDR exposure led to elevated ROS generation, whereas over-expression of SOCS1 reduced the ROS production. Figure 5b showed that the intracellular ROS level was significantly enhanced in SOCS1 knockdown cells after OGDR exposure. Figure 6c, d showed that the over-expression of SOCS1 decreased ROS production. However, ROS generation increased in SOCS1-deficient cells after stimulation with LPS. These data indicate the negative regulation of SOCS1 on ROS production in OGDR or LPS treated microglial cells.

3.6. Effect of SOCS1 on inflammation-associated TLR4 activation

Increasing evidence substantiates the critical role of TLR4 in the development of inflammation. To elaborate on the mechanisms involved in the anti-inflammatory response of SOCS1 in OGDR and LPS activated BV-2 cells, the relevance of SOCS1 and TLR4 was investigated. As shown in Fig. 6a-d, high expression of TLR4 under OGDR and LPS exposure was abrogated following SOCS1 elevation. By contrast, knockdown of SOCS1 further elevated OGDR and LPS induced TLR4 expression. Together, these data indicated that SOCS1 could directly target TLR4.

In the present study, we found that SOCS1 increased in ischemic brain tissue after stroke and in OGDR or LPS induced BV-2 microglial cells in vitro. To a certain extent, over-expression of SOCS1 could attenuate the OGDR or LPS stimulated production of proinflammatory cytokines, while SOCS1 knock-down promoted inflammation. In addition, the inflammation-related TLR4 signaling pathway, which was activated in OGDR or LPS stimulated BV-2 cell lines, was remarkably reduced by over-expressed SOCS1. Conversely, SOCS1 knock-down could reverse this effect. Moreover, ROS production was also inhibited by SOCS1 over-expression and increased by SOCS1 knockdown. In summary the current study strongly demonstrated that SOCS1 suppressed OGDR or LPS triggered inflammatory responses in BV2 microglial cells, which was partly mediated by ROS production and TLR4 abrogation.

Among the SOCS protein family, SOCS1 is expressed by immune cells, as well as CNS cells [25]. For this reason, it seems to have a potential impact on various immune processes within the CNS. The majority of studies reported that SOCS1 protein modulated inflammatory signaling in microglia [26–28]. Microglia recognized damaging stimuli and respond by generating inflammatory cytokines, such as TNF-α, IL-6, IL-1β, IFN-g, iNOS, and several chemokines [29]. SOCS1 expression is cell-type and stimulus-specific. In CNS cells, for example, astrocytes, microglia, oligodendrocytes and neurons, SOCS1 expression is induced by stimuli of IL-4, IL-6, IL-10, IFN-β, IFN-y and lipopolysaccharide (LPS) [30]. SOCS1 expressed by cells of the central nervous system could impact immune processes within the CNS, including inflammatory cytokines and chemokines production, activation of microglia,macrophages and astrocytes, immune cell infiltration and autoimmunity [31–33]. Zoledronic acid was found to induce inflammation cytokines expression through suppressing socs1 in macrophages [34]. SOCS1 was involved in the protective effects of resveratrol by reducing pro-inflammatory responses in an MPTP mouse model of Parkinson’s-like disease [35]. Additionally, deficiency of SOCS1 results in hyperresponsiveness to inflammatory stimuli in cells or animals [36, 37]. In the present study, we found that SOCS1 significantly increased in the ischemic brain after stroke, and in OGDR or LPS stimulated BV2 cells. The expression of inflammatory cytokines was also significantly increased. Recently, it was evidenced, in a mouse experimental model of ischemic stroke, that in vivo inhibition of miR-155 significantly affected the time course of cytokines expression, and other inflammation-associated molecules, accompanied by a remarkable upregulation of miR-155 direct targets, including SOCS1 and socs6 [38]. In our study, we found that the over-expression of SOCS1 could attenuate the OGDR or LPS induced release of IL-1β, IL-6, and TNF-α. However, the over-expression of SOCS1 failed to attenuate the production of iNOS. The underlying mechanism requires further exploration. SOCS1 knockdown exacerbated the production of IL-1β, IL-6 and TNF-α after OGDR or LPS stimulation.

Previous studies demonstrated that ROS was deleterious to cells because of the oxidative stress caused by their interactions with lipids, proteins and nucleic acids [13]. Oxidative stress is a common characteristic of inflammation that has a crucial role in brain injury following ischemic stroke [39]. Recently research found that IFNAR signaling inhibited RAC1 activation by SOCS1-mediated suppression of VAV1 and RAC1-GTP. While an inhibitor of RAC1 suppressed the generation of ROS [40]. In addition, in an in vitro model of diabetes, researchers found that a SOCS1 peptidomimetic blocked cytokine- and hyperglycemia-induced ROS production by inhibiting the activation and expression of NADPH oxidase [41]. In our study, we discovered that SOCS1 activation decreased ROS, and that SOCS1 knockdown increased the levels of ROS after OGDR or LPS induced inflammation. Consequently, however, the mechanisms by which SOCS1 mediated ROS needs to be continuous explored.

TLR4 is a pattern recognition receptor binding protein and activator of downstream MAPK signaling. Myeloid differentiation factor 88 (MYD88) is an important linker molecule in the TLR4 signaling pathway and is located at the center of the TLR4 signaling cascade [42]. In recent years, studies have demonstrated that SOCS1 can be induced via TLR, DECTIN-1 and other pathways [43, 44]. LPS, CPG and zymosan are TLR4 stimulant [44–46]. When TLR binds to PAMPS, it recruits MyD88 in the cytosol, which in turn activates IL receptor-associated kinase-1, 2 (IRAK), tumor necrosis factor receptor-associated factor 6 (TRAF-6), NF-κB inducing kinase (NIK) and inhibitory rkb (IKB), ultimately inducing IKB kinase phosphorylation. NF-κB activated by the degradation of IKB kinase is translocated into the nucleus, and the transcription of genes such as IL-1 and TNF-α is initiated. In recent years, attention has been paid to the crosstalk of the TLR4/MyD88 and the JAK/STAT signaling pathways. Kimura et al found that JAK2 and TLR4/MyD88 exist in cells as a complex [47]. Our study demonstrated that TLR4 signaling pathway was activated by stimulation of OGDR or LPS, and inhibited by SOCS1 over-expression, while SOCS1 knockdown further exacerbated the expression of TLR4 after OGDR or LPS induced inflammation.

In conclusion, our data suggested that SOCS1 suppressed the OGDR or LPS triggered inflammation, and inhibited the release of IL-1β, IL-6 and TNF-α, and that SOCS1 negatively regulated the expression of TLR4. Inhibitory effect of SOCS1 against inflammatory responses could be related to the ROS-dependent pathway. Our results indicated that SOCS1-regulated anti-inflammatory effects could be a potential target for the treatment of ischemic stroke.

Ethics Approval and Consent to Participate. N/A.

Consent for Publication. All authors approve to submit the manuscript to your Journal.

Conﬂict of interest.The authors declare that they have no conﬂict of interest.

AUTHOR CONTRIBUTION

Wang Weiwei and Hao Qi conceived and designed the experiments,and Wang Weiwei conducted the whole experiment in this study with the help of Zhang Tao,Wang Miao and Zhang Lijie, and Hu Jinxia participated in data arrangement. Wang Weiwei and Hu Jinxia wrote the paper, and Xiang Jie corrected the error in the manuscript.

FUNDING

This work was supported by Postgraduate Research & Practice Innovation Program of Jiangsu Province(KYCX18_1931), the Natural Science Research of Jiangsu Higher Education Institutions of China (No.17KJB320017), the Six Talent Climax Foundation of Jiangsu (No.WSN-118) and the Fundamental Research Funds for the Central Universities (2018BSCXA12).

AVAILABILITY OF DATA AND MATERIAL

The experimental data will be available on request.

Jia L, Hao F, Wang W, Qu Y. Circulating miR‐145 is associated with plasma high‐sensitivity C‐reactive protein in acute ischemic stroke patients. Cell Biochemistry & Function. 2015;33(5):314-9.
Ip CF, Zhao YM, Chan KW, Cheng YL, Tong PS, Chandrashekar O et al. Neuroprotective effect of a novel Chinese herbal decoction on cultured neurons and cerebral ischemic rats. Bmc Complementary & Alternative Medicine. 2016;16(1):437.
Jin R, Yang G, Li G. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. Journal of Leukocyte Biology. 2010;87(5):779-89.
Ji HH, Kumar VR, Kang SY, Jung HW, Park YK. Effects of Flower Buds Extract of Tussilago farfara on Focal Cerebral Ischemia in Rats and Inflammatory Response in BV2 Microglia. Chinese Journal of Integrative Medicine. 2018:1-9.
Liu CZ, He AY, Chen LQ, Limbu SM, Wang YW, Zhang ML et al. Molecular characterization and immune response to lipopolysaccharide (LPS) of the suppressor of cytokine signaling (SOCS)-1, 2 and 3 genes in Nile tilapia ( Oreochromis niloticus ). Fish Shellfish Immunol. 2016;50:160-7.
Ransohoff RM. Chemokines and chemokine receptors: standing at the crossroads of immunobiology and neurobiology. Immunity. 2009;31(5):711-21.
Chikuma S, Kanamori M, Mise-Omata S, Yoshimura A. Suppressors of cytokine signaling: Potential immune checkpoint molecules for cancer immunotherapy. Cancer Science. 2017;108(4):574-80.
Stumhofer JS, Laurence A, Wilson EH, Huang E, Tato CM, Johnson LM et al. Interleukin 27 negatively regulates the development of interleukin 17-producing T helper cells during chronic inflammation of the central nervous system. Nature Immunology. 2006;7(9):937-45.
Akihiko Y, Hitomi N, Yumiko M, Toshikatsu H. Negative regulation of cytokine signaling and immune responses by SOCS proteins. Arthritis Research & Therapy. 2005;7(3):100-10.
Pedros I, Petrov D, Artiach G, Abad S, Ramon-Duaso C, Sureda F et al. Adipokine pathways are altered in hippocampus of an experimental mouse model of Alzheimer's disease. The journal of nutrition, health & aging. 2015;19(4):403-12.
Bonini MG, Zaichik SV, Mao M, Hart PC, Chatterjee S, Malik AB et al. 62 – NOSl-Derived Nitric Oxide Promotes NF-kB Transcriptional Activity Through Inhibition of Suppressor of Cytokine Signaling (SOCS-1). Free Radical Biology & Medicine. 2015;87(10):S38-S.
Zhang Y, Zhou B, Deng B, Zhang F, Wu J, Wang Y et al. Amyloid-beta induces hepatic insulin resistance in vivo via JAK2. Diabetes. 2013;62(4):1159-66.
Morgan MJ, Liu ZG. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Research. 2011;21(1):103-15.
Lin Y, Tang G, Jiao Y, Yuan Y, Zheng Y, Chen Y et al. Propionibacterium acnes Induces Intervertebral Disc Degeneration by Promoting iNOS/NO and COX-2/PGE2 Activation via the ROS-Dependent NF-κB Pathway. Oxidative medicine and cellular longevity. 2018;2018(undefined):3692752.
Serafini M, Finamore A, Nobili F, Raguzzini A, Ambra R, Garaguso I. Redox Role ofLactobacillus caseiShirota Against the Cellular Damage Induced by 2,2′-Azobis (2-Amidinopropane) Dihydrochloride-Induced Oxidative and Inflammatory Stress in Enterocytes-Like Epithelial Cells. Frontiers in Immunology. 2018, 9:1131
Lull ME, Block ML. Microglial Activation and Chronic Neurodegeneration. Neurotherapeutics the Journal of the American Society for Experimental Neurotherapeutics. 2010;7(4):354-65.
Oh J, Hur MW, Lee CE. SOCS1 protects protein tyrosine phosphatases by thioredoxin upregulation and attenuates Jaks to suppress ROS-mediated apoptosis. Oncogene. 2009;28(35):3145-56.
Zakeri A, Yazdi FG. Toll-like receptor-mediated involvement of innate immune cells in asthma disease. Biochim Biophys Acta. 2016;1861(1 Pt A).
He Z, Zhou Y, Lin L, Wang Q, Khor S, Mao Y et al. Dl-3-n-butylphthalide attenuates acute inflammatory activation in rats with spinal cord injury by inhibiting microglial TLR4/NF-κB signalling. Journal of Cellular and Molecular Medicine. 2017;21(11):3010.
Dallas S, Block ML, Thompson DM, Bonini MG, Ronaldson PT, Bendayan R et al. Microglial activation decreases retention of the protease inhibitor saquinavir: implications for HIV treatment. Journal of neuroinflammation. 2013;10(1):58.
Shi YW, Zhang XC, Chen C, Tang M, Wang ZW, Liang XM et al. Schisantherin A attenuates ischemia/reperfusion-induced neuronal injury in rats via regulation of TLR4 and C5aR1 signaling pathways. Brain Behavior & Immunity. 2017;66:244.
Belinga VF, Wu GJ, Yan FL, Limbenga EA. Splenectomy following MCAO inhibits the TLR4–NF-κB signaling pathway and protects the brain from neurodegeneration in rats. Journal of Neuroimmunology. 2016;293:105-13.
Wu Y, Li W, Zhou C, Lu F, Gao T, Liu Y et al. Ketamine Inhibits Lipopolysaccharide-Induced Astrocytes Activation by Suppressing TLR4/NF-ĸB Pathway. Cellular Physiology & Biochemistry. 2012;30(3):609-17.
Cui G, Zuo T, Zhao Q, Hu J, Jin P, Zhao H et al. ROCK mediates the inflammatory response in thrombin induced microglia. Neuroscience Letters. 2013;554(1):82.
Shi D, Li D, Wang Q, Kong X, Mei H, Shen Y et al. Silencing SOCS1 in dendritic cells promote survival of mice with systemic Candida albicans infection via inducing Th1-cell differentiation. Immunology Letters. 2018;197:53-62.
Croker BA, Kiu H, Nicholson SE. SOCS regulation of the JAK/STAT signalling pathway. Seminars in Cell & Developmental Biology. 2008;19(4):414-22.
Neumann H, Kotter MR, Franklin RJM. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain. 2009;132(2):288.
Qin H, Yeh WI, De SP, Holdbrooks AT, Liu Y, Muldowney MT et al. Signal transducer and activator of transcription-3/suppressor of cytokine signaling-3 (STAT3/SOCS3) axis in myeloid cells regulates neuroinflammation. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(13):5004-9.
Boche D, Perry VH, Nicoll JAR. Review: Activation patterns of microglia and their identification in the human brain. Neuropathology & Applied Neurobiology. 2013;39(1):3–18.
Baker BJ, Akhtar LN, Benveniste EN. SOCS1 and SOCS3 in the control of CNS immunity. Trends in Immunology. 2009;30(8):392-400.
Henry RJ, Kerr DM, Finn DP, Roche M. FAAH-mediated modulation of TLR3-induced neuroinflammation in the rat hippocampus. Journal of Neuroimmunology. 2014;276(1-2):126-34.
Mathew AS, Kurian SS, Sundaresan N, Jayalekshmi B, Prema FR, John A et al. Pattern of Blood Component Utilization in a Teaching Hospital in South Kerala. Journal of Virology. 2014;88(24):14090-104.
Woo JH, Lee JH, Kim H, Park SJ, Joe EH, Jou I. Control of Inflammatory Responses: a New Paradigm for the Treatment of Chronic Neuronal Diseases. Exp Neurobiol. 2015;24(2):95-102.
Muratsu D, Yoshiga D, Taketomi T, Onimura T, Seki Y, Matsumoto A et al. Zoledronic Acid Enhances Lipopolysaccharide-Stimulated Proinflammatory Reactions through Controlled Expression of SOCS1 in Macrophages. Plos One. 2013;8(7):e67906.
Lofrumento DD, Nicolardi G, Cianciulli A, Nuccio FD, Pesa VL, Carofiglio V et al. Neuroprotective effects of resveratrol in an MPTP mouse model of Parkinson's-like disease: Possible role of SOCS-1 in reducing pro-inflammatory responses. Innate Immunity. 2014;20(3):249.
Berit C, Qun YX, Dolores GW, Sabin B, Wulf O, Mahavir S et al. Silencing suppressor of cytokine signaling-1 (SOCS1) in macrophages improves Mycobacterium tuberculosis control in an interferon-gamma (IFN-gamma)-dependent manner. Journal of Biological Chemistry. 2011;286(30):26873-87.
A Y, M S, R S, T H, H Y. SOCS, Inflammation, and Autoimmunity. Frontiers in Immunology. 2012;12(3):20.
Penaphilippides JC, Caballerogarrido E, Lordkipanidze T, Roitbak T. In vivo inhibition of miR-155 significantly alters post-stroke inflammatory response. Journal of neuroinflammation. 2016;13(1):287.
Rubartelli A. Redox control of NLRP3 inflammasome activation in health and disease. J Leukoc Biol. 2012;92(5):951-8.
Inoue M, Williams KL, Oliver T, Vandenabeele P, Rajan JV, Miao EA et al. Interferon-β therapy against EAE is effective only when development of the disease depends on the NLRP3 inflammasome. Science Signaling. 2012;5(225):ra38.
Lopezsanz L, Bernal S, Recio C, Lazaro I, Oguiza A, Melgar A et al. SOCS1-targeted therapy ameliorates renal and vascular oxidative stress in diabetes via STAT1 and PI3K inhibition. Laboratory Investigation. 2018(Pt 1).
Takeda K, Akira S. Microbial recognition by Toll-like receptors. Journal of Dermatological Science. 2004;34(2):73-82.
Zhang H, Zhao Z, Pang X, Yang J, Yu H, Zhang Y et al. Genistein Protects Against Ox-LDL-Induced Inflammation Through MicroRNA-155/SOCS1-Mediated Repression of NF-ĸB Signaling Pathway in HUVECs. Inflammation. 2017;40(4):1450-9.
Eberle ME, Dalpke AH. Dectin-1 stimulation induces suppressor of cytokine signaling 1, thereby modulating TLR signaling and T cell responses. Journal of Immunology. 2012;188(11):5644-54.
Crespo A, Filla MB, Russell SW, Murphy WJ. Indirect induction of suppressor of cytokine signalling-1 in macrophages stimulated with bacterial lipopolysaccharide: partial role of autocrine/paracrine interferon-alpha/beta. Biochemical Journal. 2000;349(1):99-104.
Dalpke AH, Opper S, Zimmermann S, Heeg K. Suppressors of Cytokine Signaling (SOCS)-1 and SOCS-3 Are Induced by CpG-DNA and Modulate Cytokine Responses in APCs. Journal of Immunology. 2001;166(12):7082-9.
Kimura A, Naka T, Muta T, Takeuchi O, Akira S, Kawase I et al. Suppressor of cytokine signaling-1 selectively inhibits LPS-induced IL-6 production by regulating JAK–STAT. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(47):17089.

No competing interests reported.

westernblot.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Suppressors of cytokine signalling (SOCS1) inhibits neuroinflammation by regulating TLR4 and ROS in BV2 cells

Status:

Version 1

Abstract

Objective

Materials and methods

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

2.1. Cell culture and transfection

2.2. RNA extraction and qRT-PCR

2.3. Preparation and identification of the PCDNA SOCS1 plasmid

2.4. CRISPR/CAS9-induced knock-out of SOCS1

2.5. Western blot analysis

2.6. Detection of intracellular ROS

2.7. Statistical analysis

3. Results

3.1. SOCS1 increased in the OGDR and LPS treated BV2 cells in vitro.

3.2. Oxygen glucose deprivation/reoxygenation and LPS induced the release of pro-inflammatory cytokines in BV-2 cells.

3.4. CRISPR/CAS9-mediated SOCS1 knock-out increased OGDR or LPS induced production of pro-inflammatory cytokines in BV2 cells

3.5. SOCS1 regulates OGDR or LPS induced inflammation through ROS pathway

3.6. Effect of SOCS1 on inflammation-associated TLR4 activation

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1