Isolation of the pathogen isolates
Diseased leaf samples were collected from different stone fruits viz., peach, plum, apricot, cherry and almond from Srinagar and Ganderbal districts during year 2021 (20 isolates) that were isolated on potato dextrose agar (PDA) medium. Pure culture was obtained by single spore technique and maintained on Asthana and Hawker’s medium at 24 ± 1℃ in BOD. Diseased and healthy leaf samples (control check) of stone fruits viz., peach, plum, apricot, cherry and almond were used for developing detection protocol.
Genomic Dna Extraction Of The Pathogen Isolates And Leaf Samples
Genomic DNA extraction of the pathogen isolates and leaf samples
Total genomic DNA of the pathogen isolates, infected and healthy leaf samples of five stone fruit host (peach, plum, apricot, cherry and almond) was extracted using CTAB method (10). The samples were cut and ground to fine powder in liquid nitrogen using sterilised pre-chilled pestle and mortal. The fine powder was transferred to 1.5 ml microfuge tubes containing 700µl of CTAB (Cetyl Trimethyl Ammonium Bromide) buffer maintained at 65℃ in water bath. The samples were thoroughly mixed and incubated at 65℃ for one hour in thermomixer at 500 rpm. After cooling of the microfuge tubes to room temperature, 700 µl of pre-chilled isoamyl alcohol:chloroform in 24:1 ratio was added followed by centrifugation at 12,000 rpm for 20 minutes. After centrifugation, equal volume of supernatant was taken out with the help of micropipette and placed in new centrifuge tubes. Pre-chilled isopropanol of about 700 µl was then added to these tubes containing supernatant and kept overnight at -20℃ or -80℃ for two hours. Next day (After 12 hours), the centrifuge tubes were thawed followed by centrifugation at 12,000 rpm for 20 minutes at room temperature. The centrifuged tubes were decanted to remove the supernatant and the pellet formed at the bottom was washed with pre-chilled 700 µl of 70 per cent ethanol twice followed by centrifugation at 10,000 rpm for 10–15 minutes. After centrifugation, 70 per cent ethanol was decanted and the tubes containing DNA pellets were kept inverted for drying till ethanol smell vanished. Finally, 1X TE buffer was added to the pellets according to the pellet size to dissolve the DNA and kept at -4℃ overnight. Rnase treatment @ 1 µl/ml was given at 37℃ for 2 hours in thermomixer (Eppendorf, Germany). The genomic DNA from the healthy leaves was also obtained in similar manner as control. The genomic DNA isolated from all the samples in similar way was stored at -80℃ for further use.
Dna Quantification And Quality Check
Genomic DNA extracted by CTAB method was quantified by agarose gel electrophoresis. In this method, 1.0 per cent agarose gel was prepared (1 g of agarose powder in 100ml of 1X TAE buffer in 250 ml flask). The solution was allowed to cool followed by addition of ethidium bromide @ 2µl to this mixture as fluorescent dye. The solution was poured into the cast and allowed to solidify for 15–20 minutes. Loading dye bromophenol blue (6X) was placed on Para film in drop manner and the DNA approximately 2 µl from each sample was mixed with this loading dye using micropipette followed by loading into wells of already prepared gel. The gel was allowed to run for 20 minutes at 80 Volt in gel electroporation system (Consort, Belgium) and the DNA was visualized under gel documentation system (Alpha Imager EC, Protein Simple, USA) and photographs were captured. The fluorescence intensity of each sample was compared with a standard marker (ladder) to ascertain the quantity of DNA in different samples. Quality of each sample was checked on the basis of whether single intact high molecular weight band was formed (good quality) or a smear was formed (poor quality). The quantification of DNA was also carried out using Nanodrop Bio-spectrophotometer (Eppendorf, Germany). After quantification, the DNA of each isolate was diluted to a final concentration of 20-25ng/µl using 1X TE or nuclease free water.
Designing and development of simple sequence repeat (SSR) markers for polymerase chain reaction (PCR) amplification of Wilsonomyces carpophilus
Draft genome of 29.9 Mb size of Wilsonomyces carpophilus (GenBank Accession No. PRJNA791904) distributed on 130 Scaffolds with 2851 SSR’s was used for SSR mining using Genome-wide Microsatellite Analysing Tool package (GMATA) software. After designing and custom synthesis of SSR markers, 30 SSR primers were initially screened on isolates collected from different hosts viz., peach, plum, apricot, cherry and almond (Supplementary Table 1). After standardization, 10 primers showing polymorphism were selected for further analysis (Table 1). Successful amplification was obtained by selected 10 primers on all pathogen isolates but only one SSR namely ShotholeSSR9 showed positive amplification in all the five stone fruits of infected leaf samples.
Table 1
Simple sequence repeat (SSR) markers along with their sequences developed from Wilsonomyces carpophilus genome using GAMATA software
S. No. | Primer Name | Sequence |
1 | ShotholeSSR1F ShotholeSSR1R | GCGTGGTGTTACATGGTGAG AAGATGGACGTGTGTGTGGA |
2 | ShotholeSSR2F ShotholeSSR2R | GCCGAGTTTCTTCAAAGTGC ACCAATAACAAACCCCACCA |
3 | ShotholeSSR3F ShotholeSSR3R | ATCCAGCATAACATGGCACA CTGATCGAAGGGATCGAGAG |
4 | ShotholeSSR4F ShotholeSSR4R | GTAGGGATTTACGGGCGTTT CGTGGTAACACAGCACTCGT |
5 | ShotholeSSR6F ShotholeSSR6R | GACAGACGGCTGAAGAGGAG TCACAAAACCACATGGGCTA |
6 | ShotholeSSR9F ShotholeSSR9R | GGGATGAGGGGTTAGTAGGG TGGGGAGTTTTGATGCTTTT |
7 | ShotholeSSR17F ShotholeSSR17R | TGAAGTTCGACCGTGGTGTA ATTCTTTCCCTCCCTCCAGA |
8 | ShotholeSSR18F ShotholeSSR18R | CTGGAGGCTTTCGTATTCCA TGCACAAAACACAATGCAGA |
9 | ShotholeSSR22F ShotholeSSR22R | GCCCCGAGGTACATATAGCA GCTGAAAAGGGTAGCTGTCG |
10 | ShotholeSSR30F ShotholeSSR30R | GCCCCGAGGTACATATAGCA GCTGAAAAGGGTAGCTGTCG |
*Annealing temperature for SSR markers was 60℃ |
Polymerase chain reaction (PCR) amplification of Wilsonomyces carpophilus directly from infected leaves using SSR primers
The PCR amplification was carried out in thermocycler in a PCR reaction of 25µl containing 2µl (20–25 ng/µl) of genomic DNA of pathogen isolates and from the infected leaves along the control comprised of DNA from healthy leaf samples of different stone fruits, 1X PCR buffer, 2.5 mM dNTPs, 1µM each reverse and forward SSR primer (10 pmol), 1.5 Mm Mgcl2, 1 unit of Taq polymerase enzyme and 15.8 µl of sterilized nuclease free water (NFW). PCR based SSR markers were further used for amplification of the pathogen from infected samples with PCR profile of initial denaturation at 94℃ for two minutes followed by 35 cycles of denaturation at 94℃ for 40s, annealing at 60℃ for 40s and extension at 72℃ for 40s followed by a final extension at 72℃ for 10 minutes and hold at 4℃.
Data analysis
The polymerase chain reaction (PCR) amplified products were resolved on 2.5 per cent of agarose gel (2.5 g of agarose powder dissolved in 100 ml of 1X TAE buffer) using gel electrophoresis system (Consort, Belgium) for one hour at 80 Volt and photographs captured by gel documentation system (Alpha Imager EC, Protein Simple, USA). The specific amplified alleles (bands) were compared with the 100 bp ladder to ascertain the amplified fragment size in comparison with the healthy check (Fig. 1).