Cell culture
Human OSCC( Cal27, SCC4 and SCC9) were purchased from the American Type Culture Collection. SCC4 and SCC9 were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Cal27 was cultured in Dulbecco’s Modified Eagle Medium suppled with 10% fetal bovine serum and 1% penicillin-streptomycin, routinely incubated at 37\(\text{℃}\) in 5% CO2. The cells were digested with 0.25% trypsin until the influence of cells reached 80%.
Cell Growth Assay
Cell viability was measured by a Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan). 1 x 103 squamous carcinoma cells per well were plated in 96-well plates and were cultured with 10\(\mu\)M Y-27632. At the indicated time, 10µl CCK-8 working solution was added to each well, and then the cells were incubated for 2 h at 37°C. The cell density was measured at a wavelength of 450 nm.
Wound Healing Assay
Squamous carcinoma cells were seeded in 6-well plates. The cells were scratched with a yellow sterile pipette to remove cells by lines when cells reached 100% confluence,. After wounding, the cells were maintained in medium containing Y-27632 or PBS(control). Wound closure was observed at 24h after wounding. The percentage of wound healing was calculated at 24h.
Migration Assay
For migration assay, 2x103 cells in 200\(\mu\)l medium containing 0.1% FBS were cultured in the upper chamber. The lower wells were immersed with 500\(\mu\)l medium containing Y-27632 or PBS(control). The chambers were then incubated for 24 hours at 37\(\text{℃}\). At 24h, cells migrating through the membrane were fixed in 4% paraformaldehyde after removing the non-migrated cells, followed by washing, and then stained by 1% crystal violet. The amount of cells migrating through the membrane was counted in randomly 5 microscopic fields.
Ethynyl-2’-deoxyuridine (EDU) Staining Assay
The EDU staining assay was performed by using an EDU kit (Beyotime, Shanghai, China) according to the manufacturer’s standed instruction. 1 x 105 squamous carcinoma cells per well were plated in 6-well plates. At the second day, the cells were treated with Y-27632 or PBS(control). After 24h, 50 µl EDU working solution was added to the culture medium and incubated for 1.5 h at 37˚C, then fixed with 4% paraformaldehyde for 15 min, and then incubated with 2 mg/ml glycine at room temperature for 5 min, followed by staining with Apollo ® 488 and Hoechst working solution in the darkness for 30 min. The results of EDU staining was observed and analyzed by a fluorescence microscope.
Quantitative RT-PCR (qRT-PCR) Assay
Total RNAs from cells were extracted using Trizol reagent (Invitrogen, Carlsbad, United States). Complementary DNA was reversely transcribed from total RNA using a Takara PrimeScript™ RT reagent kit (Takara Bio Inc, Shiga, Japan). And PCR reactions were performed by Takara SYBRR Premix Ex Taq™ II (Takara Bio Inc.) using a LightCyclerR 480 II. 100 ng cDNA in a 20 µl qRT-PCR reaction were used for amplification. The PCR reactions were carried out with 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and at 60°C for 20 sec, and then ended with an elongation step for 15 sec at 72°C. For results Ct values were used for relative mRNA expression quantification and human 36β4 gene was used as a housekeeping gene. PCR primers used are listed as follows:
ROCK1: Forward 5′-AACATGCTGCTGGATAAATCTGG‐3′
Reverse 5′-TGTATCACATCGTACCATGCCT‐3′;
ROCK2: Forward 5′-TCAGAGGTCTACAGATGAAGGC‐3′
Reverse 5′- CCAGGGGCTATTGGCAAAGG‐3′;
36B4: Forward 5′-GTGTAGGGGTCAAAGCACGA‐3′,
Reverse, 5′-GCAATGTTGCCAGTGTCTGT‐3′.
siRNA Transfection
Cells were transfected with siRNA ROCK1/2 or a scrambled siRNA (control) using Lipofectamine 3000 according to the manufacturer’s standard instructions. At 72 h, total RNAs from cells were extracted for RT-PCR analysis. And the oligo sequences of siRNAs were listed as follows:
ROCK1: Sense 5’-GGCAGAGGAAGAAUAUAAATT-3’
Antisense 5’-UUUAUAUUCUUCCUCUGCCTT-3’
ROCK2: Sense 5’-CUGCCUUUCAUCGGAUUUATT-3’
Antisense 5’-UAAAUCCGAUGAAAGGCAGTT-3’
Western Blot Analysis
The cells were washed with ice-cold PBS for 2 times and then lysed RIPA buffer containing 1% phenylmethylsulfonyl fluoride (PMSF) and 1% phosphatase inhibitor cocktails (Selleckchem, Shanghai, China) for 30 min at 4°C to prepare whole cell protein extracts. Then the lysate were centrifuged at 12,000 r.p.m. at 4°C for 10 min, and then the supernatants were collected. 20µg protein per lane was separated on 10% SDS-PAGE gels (Beyotime) and then electro-transferred to polyvinylidene fluoride (PVDF) membranes (Invitrogen). Membranes were blocked by 5% bovine serum albumin containing 0.05% Tween-20 (TBST) for 1h, and then were incubated with the primary antibodies overnight at 4˚C. At the second day, the membranes were incubated with optical secondary antibodies for 2h at room temperature. Chemiluminescence reagents (Millipore, St. Louis, MO, United States) was used to detect the protein bands, and bands were quantified using Image J analysis.
The following primary and secondary antibodies were used: anti-Akt (pan) (CST, #4691), anti-phosphor-Akt (Thr308) (CST, #13038), anti-ERK Thr202/Tyr204(CST, #4695), anti-phosphor-ERK (CST, #4370), anti-p70S6 kinase (CST, #2708), anti-phosphor-p70S6(Thr389 ) (CST, #9205), anti-4EBP1(CST, #9644), anti-phosphor-4EBP1 (Thr70 ) (CST, #9455) and HRP anti-rabbit (CST,#7074).
In Vivo Tumor Xenograft Assay
The animal protocol in this study were conducted according to the ARRIVE guidelines and approved by the ethics committee of the Shandong First Medical University & Shandong Academy of Medical Sciences. All methods were performed in accordance with the relevant guidelines and regulations under the Ethics Approval and Consent to Participate in China. Eight-week-old female nude/nude mice(purchased from Beijing Vital River Laboratory Animal Technology Co., Beijing, China) were randomly assigned to control and Y-27632 treatment group(10mg/kg). In all, 1X106 squamous carcinoma cells were injected intradermally into the dorsal skin of each mouse when the mice were anesthetized by isoflurane as described previously25, and 4 injection sites for each mouse. PBS or Y-27632 was then injected intraperitoneally into each mouse every day for 3 weeks. The tumor sizes were measured every three days, and the tumor volumes were calculated according to the formula V=\(\pi\)/6 x L x W x H. The weights of mice were measured three times a week. After 3 weeks, mice were euthanized and their tumors were collected from mice and weighed. The in vivo assays were repeated independently three times.
Immunofluorescence Staining
Immunofluorescence staining was performed following standard protocols as previously described26. 5\(\mu\)m sections were made from formalin-fixed paraffrin-embedded tumor tissue blocks. The sections were deparaffinized, rehydrated, and then immersed in 0.3%hydrogen peroxide to block endogenous peroxidase, followed by EDTA antigen retrieval solution according to the manufacturer’s standard protocol. After blocking with 10% goat serum for 1 hour, the slides were incubated with primary antibodies at 4°C overnight. At the second day, the slides were washed by PBS for 10min with three times, followed by incubated for 1h with DyLight488 goat anti-rabbit lgG(H + L) at room temperature in the darkness. And then the sections were incubated with DAPI to stain cell nuclei. The staining was observed and analyzed by a fluorescence microscope.