Reagents
Malt extract, yeast extract, and bacteriological agar were purchased from BD Difco (Sparks, MD, USA). Methanol and chloroform were provided by J.T. Baker (Xalostoc, Edo. Mex., Mexico). Glucose was provided by Faga Lab (Guamúchil, Sin., México). Verango® (fluopyram, 41.7% (w/v)), Lila Plus® (Paecilomyces lilacinus 3% (w/w)) and Nemacem® (Aqueous extract of Tagetes erecta, Alpha terthienyl 10% (w/w)) were provided by a local supplier.
Rhizospheric soil sample collection from the Sonoran Desert
Three zones of the Sonoran Desert were chosen for soil sampling: the Pinacate Biosphere Reserve and the Great Desert Altar (latitude: 31°31'55.01"N, longitude: 113°25'40.05" W), La Primavera (latitude: 28°48'09.70" N, longitude: 111°12'13.20" W) and El Apache (28°18 '59.60" N, 111°14'40.60" W). Two kilograms of rhizospheric soil samples from at least 10 points in every selected zone were randomly taken in sterile plastic bags at a depth of 30 cm and stored and transported refrigerated to the lab to be processed on the same day.
Isolation of bacteria
Ten grams of soil samples were suspended in 150 mL Erlenmeyer flasks containing 90 mL of sterile distilled water and were incubated at 200 rpm and 27 °C for 1 h (Innova 44, New Brunswick Scientific). Then, the soil sample suspensions were diluted in sterile distilled water (up to 10-4). After that, 0.5 mL of the diluted suspensions was inoculated into petri dishes containing ISP2 agar (10 g/L malt extract, 4 g/L yeast extract, 4 g/L glucose and 20 g/L bacteriological agar) and incubated at 40 °C for 72 h. Isolated colonies were transferred to new Petri dishes with fresh ISP2 agar and incubated again at 40 °C for 72 h. Axenic cultures were stored at 4 °C for further analysis.
Submerged culture to obtain secretomes
Submerged cultures of isolated strains were established in 250 mL Erlenmeyer flasks containing 50 mL of ISP2 broth. The culture media were inoculated with a single colony of the axenic strains and incubated at 37 °C at 180 rpm for 72 hours (Innova 44, New Brunswick Scientific). Then, the culture media were centrifuged at 10,034 x g and 4 °C for 20 minutes (Allegra 64R Centrifuge, Beckman Coulter), and supernatants (cell-free) containing secretomes were stored at -20 °C for further chemical analysis or bioassays.
Chemical characterization of secretomes by thin-layer chromatography (TLC)
The selected secretomes with the highest nematicidal activities were freeze-dried (Yamato DC401 freeze dryer), and metabolites contained in the lyophilized powder were further extracted with methanol. To this end, 300 µL of each solvent was added to 8 mg of lyophilized secretome and sonicated for 15 minutes in an ultrasonic bath (Branson 2510). Then, the samples were centrifuged (Eppendorf Centrifuge 5417R) at 9,279 x g and 4 °C for 10 minutes, and the supernatants were collected for TLC analysis. Eight microliters of the extracts were spotted on silica gel plates (10 x 10 cm, TLC Silica gel 60 F254, Merck) and eluted with a mobile phase containing chloroform:methanol:distilled water (65:25:4 v/v). After elution, compounds were visualized with UV light (A: 254, and C: 365 nm), ninhydrin (sprayed with 0.1% w/v ethanol and heated at 60 °C for 15 min) or iodine vapors.
Molecular identification of bacterial strains
Genomic DNA extraction
Genomic DNA was extracted from a liquid culture of isolate TB 197 grown aerobically for 24 h at 30 °C. using the PowerSoil® DNA isolation kit (MO BIO Laboratories Inc.) according to the standard protocol provided by the manufacturer.
PCR amplification of the 16S rRNA, gyrA, rpoB, purH, and groEL genes
PCR amplification of marker genes was performed using OnePCR™ Ultra Supermix with Fluorescent Dye (Bio-Helix) according to Ben Gharsa (2021) methodology with some modifications. The primer pairs used for the 16S rRNA, gyrA, rpoB, purH and groEL genes are detailed in Table 1. For all markers, a Studio™ 5 Real-Time PCR System was used (Applied Biosystem by Thermo Fisher Scientific), with a unified PCR program that consisted of 1) an initial denaturation phase at 95 °C for 5 min; 2) 30 cycles of denaturation at 95 °C for 40 s, annealing at 56 °C (for the 16S region) or 55 °C (for the other genes) for 1 min and elongation at 72 °C for 30 s; and 3) final elongation at 72 °C for 2 min.
The amplified 16S rRNA, gyrA, rpoB, purH and groEL products were confirmed by horizontal agarose gel electrophoresis with 1Kb Plus DNA ladder RTU (Bio-Helix). The gels were visualized on a UVP® High-Performance UV Transilluminator (Thermo Fisher Scientific).
Table 1. Primers used for the molecular identification of bacterial strains
Gene
|
Primer
|
Primer Sequence (5´-3´)
|
Reference
|
16S rRNA
|
27F
|
AGAGTTTGATCMTGGCTCAG
|
Ben Gharsa et al. 2021
|
1492R
|
TACGGYTACCTTGTTACGACTT
|
gyrA
|
42F
|
CAGTCAGGAAATGCGTACGTCCTT
|
Ben Gharsa et al. 2021
|
1066R
|
CAAGGTAATGCTCCAGGCATTGCT
|
rpoB
|
2292F
|
GACGTGGGATGGCTACAACT
|
Ben Gharsa et al. 2021
|
3354R
|
ATTGTCGCCTTTAACGATGG
|
purH
|
70F
|
ACAGAGCTTGGCGTTGAAGT
|
Ben Gharsa et al. 2021
|
1013R
|
GCTTCTTGGCTGAATGAAGG
|
groEL
|
550F
|
GAGCTTGAAGTKGTTGAAGG
|
Ben Gharsa et al. 2021
|
1497R
|
TGAGCGTGTWACTTTTGTWG
|
Sequencing and phylogenetic analysis of the 16S rRNA, rpoB, gyrA and groEL genes
The PCR products were purified and analyzed by PSOMAGEN. Raw sequence data were combined into a single consensus sequence for each marker gene using the MEGA program version 10.0.05 (Kumar et al. 2018). The consensus sequences obtained were used as queries in GenBank database searches using the BlastN algorithm (NCBI GenBank database). Phylogenetic analysis was performed using MEGA software version 10.0.05 (Kumar et al. 2018). Evolutionary distances were calculated by Kimura's two-parameter model (Kimura, 1980). Phylogenetic trees based on the 16S rRNA, gyrA, rpoB, purH and groEL sequences of the isolates and different strains retrieved from NCBI GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi) were constructed using the neighbor-joining method (Saitou & Nei 1987) with bootstrap values based on 1000 replicates. The obtained 16S rRNA, gyrA, rpoB, purH and groEL gene sequences of the isolates were submitted to the GenBank database.
Collection and synchronization of larval and egg stages of phytopathogenic nematodes
Nematode synchronization was performed based on the Zhao et al. (2020) methodology with some modifications. Tomato roots highly infested with Meloidogyne incognita, M. enterolobii or Radopholus similis were collected and vigorously washed with water to remove any adhered soil. The roots were carefully cut into 2–4 cm long pieces and placed into a blender containing a NaOCl solution (2% w/v) to grind for 30 s. The crushed roots were rinsed with tap water and passed through 100-, 325- and 500-mesh sieves. Second-stage (J2) juveniles of PPN retained on the 325-mesh sieves and eggs retained in the 500-mesh sieves were suspended in sterile tap water and stored at 15 °C for further analysis. On average, approximately 200 J2s or eggs per milliliter were collected by this procedure (five counts visualized at 10X, MOTIC, AE 2000, inverted microscope).
In vitro screening for nematicidal activity
In vitro nematicidal activity bioassays employing M. incognita J2 larvae in aqueous suspension were performed according the methodology of Ala et al. (2020) with some modifications. Twenty microliters of secretomes obtained from submerged cultures were added to 96-well flat-bottom sterile polystyrene microplates (Corning® Costar® 3595) containing 40-60 J2 larvae suspended in 200 µL of sterile tap water per well. Subsequently, the plates were sealed with parafilm and incubated at 25 °C in the dark for 48 h, and motile and immotile larvae (considered death) were counted at 10X amplification (MOTIC, AE 2000, inverted microscope).
All experiments were performed considering three biological replicates (with three technical repeats each). Nematicidal activity was estimated according to Eq. 1.
Nematicidal activity evaluation of secretomes in field assays
The evaluation was performed on a tomato (Solanum lycopersicum L.) crop within the presence of a shade mesh (∼50% reduction of sunlight radiation) at Agroindustrias Tombell (Culiacan, Sinaloa-Mexico). The experimental area was selected based on previous analyses of the nematode populations, and areas with the highest level of M. enterolobbi infestation were selected. Tomato seedlings of the commercial Dionysus® hybrid (Ahern Seeds) were transplanted into cultivation plots, and the following three treatments were applied: 1) conventional management (undisclosed by the farmer), 2) secretome of the selected strain from in vitro screening and 3) Verango® (fluopyram, 41.7%, as a positive control). The secretome of the selected strain was applied at a concentration of 8 L/ha, while Verango® was applied at 1 L/ha. A total of 12 applications were made using a drench system with intervals of eight days between them for a period of 90 days. Each experimental unit consisted of three plots (1.80 m between them) and was 50 m long (270 m2 per treatment). Only the central plot of each treatment was evaluated to avoid the influence of adjacent treatments.
To evaluate the root damage produced by nematodes, root washings were performed at 30, 60 and 90 days after transplantation, for which 10 plants were selected randomly from the central plot of each treatment. The galling index (GI) in tomato roots was determined based on the visual scale proposed by Baker (1978) (Table 1S and Fig. 1S) in a range of 0-5, where 0 represents 0% galling and 5 represents greater than 80%.
Biological control in greenhouse assays
The assays were performed at Centro de Investigación en Alimentación y Desarrollo, (Culiacan, Sinaloa, Mexico) in the spring of 2020 (March and April). Taureg hybrid tomato seeds were sown directly in plastic pots under aseptic conditions at a greenhouse temperature of ~25 °C and 16 h of daylight. A cluster of 4 to 6 seeds was sown approximately 1.5 inches deep in a 15-cm-wide pot, which was filled with 1.0 kg of a high-quality well-drained potting mix. The plants were watered every three to four days, and when they were 30 days old, a suspension of M. enterolobbi eggs (approximately 1500 eggs per pot) was inoculated using a sterile micropipette following standard inoculation procedures (Naz and Khan 2013).
To evaluate the biological control in greenhouse assays, 400 mL of a) water (negative control), b) selected strain endospores (1x106 spores/mL), and c) Verango® (fluopyram, 41.7%, as a positive control, 1 L/ha) were applied by irrigation to twenty plants postinoculation of the M. enterolobii eggs. After 30 and 60 days of nematode inoculation, 5 plants from each treatment were picked randomly, and the roots were carefully washed to remove soil remnants. The galling index was measured to evaluate the biological efficacy of the treatments applied according to the aforementioned visual scale proposed by Baker (1978) (Table 1S, Fig. 1S). The egg number per pot was also recorded by counting under an inverted microscope to determine the reproduction factor (RF) of M. enterolobii according to Eq. 2.
Biological control in open field assays
Root-knot nematodes
Biological control of the root-knot nematode M. incognita was conducted in Calvillo, Aguascalientes, Mexico, in tomato plants (Solanum licopersicum) of the Optimax variety during May and June 2022. A randomized complete block design was employed, where 100 mL (per plant) of a) water as a negative control, b) B. paralicheniformis TB197 strain endospores (1 x 108 spores/g; 4 kg/ha) and 3) Lila Plus® as a positive control (Purpureocillium lilacinum, 0.48 kg/ha) were applied by uniform drenching after 4 weeks of tomato crop growth in four replicate plots (1.8 x 4 m) per treatment. At 15 and 30 days after the treatments, 5 plants were extracted from each plot (20 plants per treatment), and the galling index was determined by the visual scale described previously (Table 1S, Fig. 1S). Additionally, to determine the population density of M. incognita J2 at the beginning, middle and end of the assay, 100 g of roots of 4 different plants for each treatment were obtained by 4 zigzag samplings and processed for the extraction and quantification of M. incognita (J2, five counts visualized at 10X, MOTIC, AE 2000, inverted microscope) as described previously.
Burrowing nematodes
The biological control of the burrowing nematode Radopholus similis was conducted in Cihuatlan, Manzanillo-Mexico in banana (uss asp.) of the gran nain cultivar during May and June 2022. A randomized complete block design was employed, where 100 mL of a) water (negative control), b) B. paralicheniformis TB197 strain (1 x 108 spores/g; 4 kg/ha) and c) Nemacem® (6 L/ha, positive control) were applied by uniform drenching in four replicate plots (1.8 x 4 m) per treatment. At 15 and 30 days of the assay, 5 plants were extracted from each plot (20 plants per treatment), and the necrosis index was determined based on a visual scale of 0 to 5 proposed by Coyne et al. 2007 (Table 2S). To determine the population density of R. similis J2 at the beginning, middle and end of the assay, 100 g of roots of 4 different plants for each treatment were obtained by 4 zigzag samplings and processed for the extraction and quantification of R. similis J2 as described previously.
Statistical analysis
The results of all experiments are reported as the mean ± standard deviation. One-way analysis of variance (ANOVA) and Tukey‒Kramer (95% confidence limit) tests were performed to establish significant differences among treatments using NCSS software (Number Cruncher Statistical System or Windows, Kaysville, UT, USA, version 7.0).