Patient information
Fourteen healthy controls (HC), seven MS patients with stable disease (SMS), and eight MS patients with active disease (AMS) were enrolled in this study. AMS was defined as the presence of at least one cerebral enhancing lesion (CEL) at the time of blood collection; patients with stable disease (SMS) had no CEL at the time of sampling (Table 1). Blood from HC was collected from volunteers at the Transfusion Medicine Blood Bank of the National Institutes of Health (Bethesda, MD). All MS patients were enrolled in an IRB-approved natural history study. Both HC and MS patients signed informed consent prior to participation. Donors for the mixed lymphocyte reaction experiments were obtained from The Wistar Institute’s blood donation program.
Cell Isolation Generation of Spontaneous Lymphoblastoid Cell lines (SLCLs) and tissue culture conditions
Peripheral blood mononuclear cells (PBMCs) from HC donors and MS patients were isolated from whole blood by ficoll-hypaque density centrifugation and cryopreserved in freezing media containing 20% DMSO. SLCLs were generated by spontaneous expansion from PBMCs in the presence of cyclosporin A to eliminate T cells 48. Briefly, PBMCs were thawed in growth medium [RPMI-1640 medium (Gibco, Gaithersburg, MD) with 10% fetal bovine serum (FBS; Gibco, Gaithersburg, MD), 1% gentamicin (50mg/ml; Quality Biological, Gaithersburg, MD), and 1% L-Glutamine (200mM; Quality Biological, Gaithersburg, MD)] and then plated in 96-well round bottom plates at a density of 1x106/well in a total volume of 200µl. Once per week, 100µl medium was removed and replaced with fresh growth medium. After 3 weeks, a final concentration of 2µg/mL of cyclosporin A (Sigma-Aldrich, St. Louis, MO) was added to each well (Fig. 1A). Three to six weeks later, clusters of B-lymphoblastoid cells (i.e., spontaneous lymphoblastoid cell lines; SLCLs) emerged (Fig. 1A) and were transitioned into progressively larger tissue culture wells until they were robust and numerous enough to be cultured in T25 flasks. Once established, SLCLs were maintained in growth medium and incubated at 37°C under a 5% CO2 humidified atmosphere.
Carboxyfluoresein succinimidyl ester (CFSE) Proliferation Assay
SLCLs were labeled with 1.5 µM CFSE (Invitrogen, Waltham, MA) and incubated for seven days. CFSE dilution was measured by flow cytometry using a BD-LSR II (BD Biosciences; Bedford, MA) and proliferation indices were calculated using FlowJo software (Ashland, OR).
Cell viability assay
SLCLs, LCLs (B95.8 transformed), and an EBV (-) cell line (BJABS) were plated in growth medium at 8 x 103 cells (in 100 µl) per well in an opaque 96-well plate. The Cell Titer-Glo® Cell luminescent Cell Viability Assay (Promega, Madison, WI) was used as per kit instructions. Briefly, Cell Titer-Glo® substrate and buffer were combined and 100 µl of this mixture (1:1 ratio of Cell Titer-Glo®: cell mixture) was added to each well and mixed. The plates were then incubated for 20 minutes (for cell lysis to occur), and luminescence was measured on a CLARIOstarPlus (BMG Labtech, Ortenberg, Germany) multilabel plate reader to determine cell viability; the generation of a luminescent signal is proportional to the amount of ATP present. This assay was performed on Day 2 and Day 4 after plating and the percent increase in luminescence in 48 hours (between Days 2 and 4) was calculated.
EBV viral load
DNA was isolated from SLCLs, LCLs (B95.8 transformed LCLs; one from an MS patient, one from a HC), and BJABS (EBV negative control cell line) using a DNeasy blood and tissue kit (Qiagen, Hilden, Germany). PCR was used to quantify EBV viral load using a standard curve generated with Namalwa cells (two copies of EBV per cell). Primers used include: EBNA1 F 5’- TCA TCA TCA TCC GGG TCT CC-3’; EBNA1 R 5’- CCT ACA GGG TGG AAA AAT GGC − 3’; b-actin F 5’- GCC ATG GTT GTG CCA TTA CA-3’; b-actin R 5’- GGC CAG GTT CTC TTT TTA TTT CTG-3’.
Extracellular staining for cell surface markers and EBV lytic genes
For extracellular staining, cells were treated with a human FcX blocker antibody mix (BioLegend, San Diego, CA) for 20 min. Cells were then washed with FACS buffer (PBS, 5% FBS, 0.1% NaN3 sodium azide) and centrifuged at 1,500 rpm for 5 minutes before staining for 30 minutes at 4°C with the appropriate cocktail containing antibodies to one or more of the following: CD19, CD20, CD21, CD11c, CD80, CD86, EA-D, and/or ZTA. After incubation with antibodies for cell surface markers, cells were washed with FACS buffer, centrifuged at 1,500 rpm for 5 minutes, and then resuspended in 500 µl FACS buffer for immediate analysis by flow cytometry using a BD-LSR II (BD Biosciences, Bedford, MA). Compensation was determined using CompBeads (BD Biosciences, Bedford, MA) and single stained fluorescent samples. Doublet discrimination (FSC-H: FSC-A) was performed, and dead cells were excluded using the live/dead discrimination dye Zombie IR (BioLegend, San Diego, CA) before analysis using FlowJo software (Ashland, OR).
Western blot for EBV latent and lytic genes
Cell lysates were prepared in radioimmunoprecipitation assay (RIPA) lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS,1 IGEPAL, 10mM glycero-phosphate, 1mM sodium phosphate, 1mM sodium orthovanadate, 1 mM EDTA) supplemented with phenylmethysolfonyl fluoride, benzonase, and 1× protease inhibitor cocktail (Thermo Scientific, Waltham, MA). Protein extracts were obtained by centrifugation at 3,000 × g for 10 min at 4°C. Protein concentrations were equalized using a bicinchoninic acid (BCA) protein assay (Pierce, Appleton, WI) and lysates were subsequently boiled with 2× Laemmli sample buffer (Bio-Rad, Berkley, CA) with 2.5% β-mercaptoethanol (Sigma-Aldrich, St. Louis, MO). Proteins were resolved by gel electrophoresis on an 8–16% Tris-glycine precast gel (Invitrogen, Waltham, MA) and transferred to an Immobilon-P membrane (Millipore, Burlington, MA). Membranes were blocked in 5% milk in PBS-T for 1 h at room temperature and incubated overnight at 4°C with primary antibodies against EBNA1 (EBS-I-024; Thermo Scientific, Waltham, MA), EBNA2 (MABE8; Millipore, Burlington, MA), LMP1 (M0897; Dako, Santa Clara, CA), EBNA3C (LS-C14045; LS Bio, Seattle, WA), EAD (ab30541; Abcam, Cambridge, United Kingdom), and b-actin (A3854; Sigma-Aldrich, St. Louis, MO) as recommended per the manufacturer. Anti-Zta antibody was generated in-house. Membranes were washed, incubated for 1 h with the appropriate secondary antibody, either goat anti-rabbit IgG-HRP, rabbit anti-mouse IgG-HRP, or anti-sheep IgG. Membranes were then washed and detected by enhanced chemiluminescence.
EBV and host gene expression analysis
RNA was isolated from SLCLs using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and treated with deoxyribonuclease (Qiagen, Hilden, Germany). Reverse transcription followed by real-time quantitative PCR (RT-qPCR) was used to measure EBV gene expression levels. Primers used for qPCR of EBV genes include: EBNA1 F (5’-GGTCGTGGACGTGGAGAAAA-3’), EBNA1 R (5’-GGTGGAGAC CCGGATGATG-3’); Zta F (5-TCTGAACTAGAAATAAAGCGATACAAGAA-3’), Zta R (TTGGGCACATCTGCTTCAAC); EA-D F (5’- TTGGGCAGGTGCTGTTGAT-3’), EA-D R (5’- TGCCCACTTCTGCAACGA-3’); LMP1 F (5’-TCCAGAATTGACGGAAGAGGTT-3’), LMP1 R (5’-GCCACCGTCTGTCATCGAA-3’); LF3 F(5’-GCCAATAACTACCTGCCCCT); LF3 R(5’-AGACTTTCGGGGCATTGGTG-3’). Primers used for qPCR of host genes include: IL12B F (5’-TGCCCTGCAGTTAGGTTCTG), IL-12B R(5’-TGGGTCTATTCCGTTGTGTCT-3’), FOXP1 F(5’-GTGGCAAGACAGCTCCTTCT-3’), FOXP1 R (5’-ATAGCCACTGACACGGGAAC-3’; HAVCR2 F(5’-GCATCTACATCGGAGCAGGG-3’), HAVCR2 R(5’-TTGGCCAAAGAGATGAGGCTTA-3’); BIRC3 F(5’-GACTGGGCTTGTCCTTGCT-3’), BIRC R (5’-GAAGAAGTCGTTTTCCTCCTTTG-3’). Glucuronidase beta (GUSB) was used as a cellular control: GUSB (5’-CGCCCTGCCTATCTGTATTC and 5’-TCCCCACAGGGAGTGTGTAG-3’). The average cycle threshold (CT) was determined by three independent samples. Template-negative (quantitative PCR reaction mixtures without cDNA) and RT-negative (RNA after genomic DNA elimination) conditions were used as controls. All data were normalized to the housekeeping gene GUSB.
Whole genome sequencing and analysis
DNA was extracted from SLCLs using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The Illumina DNA preparation kit was used for sequencing library preparation according to the manufacturer’s instructions. Sequencing was done with an Illumina NextSeq 500 system in high-output mode to generate a total of ∼4 × 108 paired-end 75-bp reads. Fastq reads were aligned against the EBV genome (accession NC_007605.1) using the BWA algorithm 49. Analysis of heterogeneous sites was performed following the procedure described by Čejková et al. 50. The consensus EBV genome for each sample was extracted using samtools51. Circus plots were generated using the R BioCircos package. Proteins were translated from nucleotide sequences using Geneious prime 2022.2 (https://www.geneious.com). Nucleotide and protein sequences were aligned using MAFFT 52v7.407 and visualized using Geneious prime 2022.2. Reference EBNA1 regions, in addition to the sequence from NC_007605.1, were obtained by querying each SLCL-derived sequence against nr using tblastn and taking differentially occurring sequences between matches for the three groups of samples (HC, AMS, SMS). One representative for each of three groups of identical sequences was kept. A phylogenetic tree of the 13 resulting sequences (9 samples, 4 reference) was constructed using PhyML with default parameters and visualized using iTOL53,54.
Phylogenetic Analysis
A Maximum Likelihood tree (Supplemental Fig. 2A) was built using all available complete genomes and the study consensus sequences. After performing a quality control check, genomes were aligned by MAFFT using NC 007605 as a reference. A maximum likelihood phylogeny was inferred using RAxML v8.2.4 using a GTR substitution model55,56accounting for among-site rate heterogeneity using the Γ distribution and four rate categories (GTRGAMMA model)57 for 100 individual searches with maximum parsimony random-addition starting trees. Node support was evaluated with 100 nonparametric bootstrap pseudoreplicates58. The initial ML newick tree and the whole-genome alignment, were used as input for ClonalframeML to infer recombination using 100 pseudo-bootstrap replicates59,42 For better visualization, the tree was edited using iTol website (v4.2.3) and Microreact (v214)60,61.
Chromatin immunoprecipitation (ChIP) assay
We previously described a chromatin immunoprecipitation (ChIP) assay to measure EBNA1 protein binding to viral and cellular DNA elements in AMS, SMS, and HC SLCLs 62. Briefly, SLCLs were harvested and cells were crosslinked in 1% formaldehyde for 15 min, followed by quenching for 5 min with 0.125 M glycine, and then lysed in 1 ml SDS lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl, pH 8.0) containing 1 mM PMSF and protease inhibitor cocktails (Sigma-Aldrich, St. Louis, MO), and kept on ice for 10 min. Lysates were sonicated with a Diagenode Bioruptor, cleared by centrifugation to remove insoluble materials, diluted 10-fold into IP Buffer (0.01% SDS, 1.1% Triton X-100, 1.2mM EDTA, 16.7mM Tris pH 8.0, 167mM NaCl, 1 mM PMSF, and protease inhibitors cocktail), and incubated with rabbit anti-EBNA1 antibody (2 µg/reaction) or IgG control for immunoprecipitation overnight at 4˚C before washing five times in wash buffer at 4˚C and eluting with 150 µl Elution buffer (10mM Tris, pH 8.0, 5mM EDTA, and 1% SDS) at 65°C for 30 min. The elutes were then incubated at 65°C overnight to reverse cross-linking, and further treated with Proteinase K in a final concentration of 100 µg/ml at 50°C for 2 hrs. ChIP DNA was purified by Quick PCR Purification Kit (Life Technologies, Waltham, MA) following the manufacturer’s instruction. Real-time quantitative PCR (ABI 7900HT Fast Real-Time PCR System; Applied Biosystems, Waltham, MA) was performed on ChIP DNA to quantitate two EBV loci (DS50 and Qp) and one cellular locus (CLIC1), which have been reported to associate with EBNA1. Results were quantified as % input. Primer sets used for ChIP were as follows: DS50 F (5’- ATGTAAATAAAACCGTGACAGCTCAT-3’), DS50 R (5’- TTACCCAACGGGAAGCATATG-3); QP F (5’- AAATTGGGTGACCACTGAGGGAGT-3’), QP R (5’- ATAGCATGTATTACCCGCCATCCG-3’); CLIC1 F (5’-CCTAAGCTGAGGGTGATTCATCTC-3’), CLIC1 R (5’- CCCCACATCCTTGACAGGAA-3’).
RNA Seq and RNA-Seq
Total RNA was isolated from 2 × 106 cells using the RNeasy Mini Kit (Qiagen, Germany) and treated with deoxyribonuclease (Qiagen, Hilden, Germany), following the manufacturer’s protocol. RNA samples were submitted to the Wistar Institute genomics core facility for initial analysis of RNA quality, with each sample having an RNA integrity number (RIN) value greater than 8.5 (TapeStation; Agilent Technologies, Santa Clara, CA). Sequencing library preparation for SLCLs was completed using the ScriptSeq RNA-seq library preparation kit. Sequencing was performed with an Illumina NextSeq 500 system in high-output mode to generate ∼140 × 106 reads (2 × 75 bp) across three multiplexed and pooled samples. The QuantSeq 3′-mRNA kit (Lexogen) was used to generate Illumina-compatible sequencing libraries according to the manufacturer’s instructions. Sequencing was done with an Illumina NextSeq 500 system in high-output mode to generate ∼4 × 108 reads (1 × 75 bp) across 12 multiplexed and pooled samples.
RNA-seq data was aligned using the bowtie2 63 algorithm against the hg19 human reference genome and RSEM v1.2.12 software 64 was used to estimate read counts and RPKM values using gene information from Ensemble transcriptome version GRCh37.p1365. DESeq2 was used on raw counts to estimate significance of expression differences between any two experimental groups and generate normalized counts. Gene set enrichment analysis was done using QIAGEN's Ingenuity® Pathway Analysis software (IPA®; QIAGEN, Redwood City, CA; www.qiagen.com/ingenuity) using “Canonical pathways” and “Upstream regulators” option. Top significant results with at least 4 genes and with predicted activation state Z-score of at least |Z|>1 were reported.
Intracellular Cytokine Staining
Phorbol myristate acetate (PMA; 20 ng/ml, Sigma-Aldrich), Ionomycin (500 ng/ml, Sigma-Aldrich), and Golgi stop (Monensin, BD Bioscience, East Rutherford, NJ) were added to 1x106 cells four hours prior to staining with live/dead reagent to exclude dead cells (Zombie/NIR, Biolegend, San Diego, CA) and anti CD19(BD Biosciences, East Rutherford, NJ). Cells were subsequently fixed and permeabilized with fixation/permeabilization buffer (BD Bioscience, East Rutherford, NJ). Antibodies for IL-6 and LTA (BD Bioscience, East Rutherford, NJ) were added and incubated for 30 min on ice. Samples were then washed twice and analyzed by flow cytometry with a BD-LSR II (BD Biosciences, Bedford, MA).
Mixed lymphocyte reactions
Whole blood was collected from an individual donor and immediately diluted 1:1 with sterile DPBS supplemented with 2% FBS. Next, 15ml of Lymphoprep (STEMCELL Technologies, Vancouver, CA) was added through the insert hole of SepMate-50 columns (STEMCELL Technologies, Vancouver, CA), and 30ml of diluted blood was slowly layered over top. Tubes were then spun at 1200 x g for 10 mins at room temperature with full brake (as per manufacturer’s instructions). Supernatant was then transferred to a normal 50ml conical tube, being careful to minimize transfer of the loosely packed erythrocyte layer. Supernatant volume was increased to 50ml with DPBS/2% FBS and spun at 500 x g for 10mins. The supernatant was then removed, and wash was repeated a minimum of 4 additional times. Prior to the final wash, total numbers of peripheral blood mononuclear cells were counted. CD4 T cells were isolated from PBMC using Dynabeads Untouched Human CD4 T cells kit following the manufacturer’s protocol (Invitrogen, Waltham, MA). CD4 T cells were diluted such that 25,000 cells were added per 100 µl in each well of a 96-well plate. HC1 and AMS4 LCLs were treated with 50 µg/ml mitomycin C (Sigma-Aldrich, St. Louis, MO) for 20 min at 37 ̊C, washed three times, and diluted such that 5,000 cells were added per 100 µl in each well of a 96-well plate. The use of mitomycin C prevented HC1 and AMS4 LCLs from overgrowing the culture. CD4 T cells were cultured alone (Negative), with anti-CD3/CD28 Dynabeads Human T-Activator (Thermo Fisher Scientific, Waltham, MA) (Positive), or with 5,000 HC1 or AMS4 SLCLs in RPMI medium -/+ TAF for 6 days. Cell viability was determined using the CellTiterGlo assay (Promega, Madison, WI) at day 6.
ELISpot
HC1 and AMS4 LCLs were treated with 50 µg/ml mitomycin C as described above, and co-cultured with PBMC -/+ TAF for 7 days. Then CD4 T cells were isolated from each group using Dynabeads Untouched Human CD4 T cells kit following the manufacturer’s protocol (Invitrogen, Waltham, MA) and seeded at a density of 100,000 cells/well to 96-well ELISpot-plates (Millipore, Burlington, MA) pre-coated with either TNF-α ELISpot Development Module (SEL210, R&D Systems, Inc.) or IFN-𝛾 ELISpot Development Module (SEL285, R&D Systems, Inc.). Cells were incubated at 37 ̊C for 24h, after which cells were removed and proceeded to color development with ELISpot Blue Color Module following the manufacturer’s protocol (SEL002, R&D Systems, Inc., Minneapolis, MN). Color development was stopped with a water wash and the plate was air-dried overnight at RT away from light. Spots were enumerated using an automated spot counter (ImmunoSpot® CTL S6 Micro Analyzer; Cellular Technology Limited, Shaker Heights, OH).