Animals
Adult male Wistar rats weighing 200–250 g were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The animals were kept in a constant temperature and humidity environment with a 12-hour light, 12-hour dark cycle. Water and food were freely available. All animal handling procedures were carried out in accordance with the guidelines approved by the First Affiliated Hospital's Institutional Animal Care Committee (Zhejiang University School of Medicine).
Animal Surgery
Sevoflurane (3%) was breathed to anaesthetize rats. MCAO was conducted as previously mentioned[16]. Following the midline neck incision and separation of the omohyoid muscle, the right common carotid artery was isolated. Through the external carotid artery stump, a 4 − 0 surgical monofilament nylon suture was inserted into the right internal carotid artery. It was then advanced 1.8 cm past the carotid bifurcation to occlude the right middle cerebral artery (MCA). A Laser Doppler flowmetry was used to monitor the blood flow of the right MCA (PeriFlux 5000; Stockholm, Sweden). A successful occlusion was defined as a decrease in blood flow of more than 25% from the baseline. Throughout the surgery, a heating pad kept the patient's body temperature at 37 ± 0.5°C. Sham-operated rats underwent the same procedures, with the exception of nylon filament insertion. The animals were given free access to water and food at room temperature (21–23°C)..
Drug Administration
One week after MCAO, rats were randomly assigned to one of three groups: sham, vehicle, or CN04-A (a Rac1 activator, Cytoskeleton, Inc., Denver, CO, USA). CN04-A (424nmol/mL, 1µL) was injected into the right cerebral ventricle of anaesthetized rats using a Hamilton syringe. 3 mm rostral to the bregma, 2 mm lateral to the midline, and 2 mm ventral to the skull surface were the coordinates chosen. The injection rate was 0.2 µL/min, and the needle was left in place for 5 minutes after administration before being progressively withdrawn. The vehicle (saline) was delivered intracerebroventricularly to both the sham and MCAO groups.
Behavioural Assessment
The neurobehavioral assessment was carried out by an investigator who was blind to the study design and treatment, utilising modified neurological severity ratings (mNSS) and rotarod tests. For mNSSs, the neurologic function of the rat was evaluated using a composite of motor, reflex, and balance tests on a scale of 0 to 14 [17]. For rotarod tests, rats were given one minute to acclimate to the rod before it was sped to 40 rpm for two minutes, and the time spent on the rod was recorded.Baseline values of mNSSs and rotarod tests were obtained by averaging 6 trials prior to surgery, and rats were tested for ≤ 5 weeks after surgery.
Brain Atrophy Measurement
Immediately after euthanizing, rat brains were removed and frozen. Twenty-µm coronal sections were cut − 2.9 to -4.5 mm from the bregma, mounted on slides and stained using cresyl violet. ImageJ software (National Institutes of Health, Bethesda, MD) was used to compute the atrophic area, which was then multiplied by the section interval thickness.
Bielschowsky Silver Staining And Mbp Immunohistochemistry
Bielschowsky silver staining is an essential approach for detecting axonal regrowth in mouse brains following MCAO[18, 19]. As previously mentioned, Bielschowsky silver staining was used in the current investigation to observe myelinated axons[20]. Briefly, rats were euthanized 14 days following surgery, and the brain was fixed by transcardial perfusion with 4 per cent paraformaldehyde, followed by overnight immersion in 4 per cent paraformaldehyde. Then the brains were embedded in paraffin and paraffin blocks were serially cut into 8 µm sections − 3.0 mm ± 0.5 mm from the bregma. Sections were immersed in 20% silver nitrate for 25 minutes at 37°C in the dark, rinsed with distilled water, and treated dropwise with the ammoniacal silver solution. After that, the sections were washed with water before being submerged serially in 10% formaldehyde, distilled water, and 5% sodium thiosulfate.
MBP is a marker of myelination, and decrease of MBP level indicates impaired axon myelination after MCAO[21]. In the current study, MBP immunohistochemistry was performed as previously described to detect post-ischemia white matter injury and repair[20]. Briefly, rats were euthanized 14 days after surgery, paraffin blocks were made as described above. Six-µm sections − 3.0 mm ± 0.5 mm from the bregma were cut, deparaffinized, and incubated with MBP monoclonal antibodies (1:200, Abcam, Cambridge, UK) and HRP-labeled secondary antibodies.
The results of bielschowsky silver staining and MBP immunohistochemistry were quantified in a blinded manner. Every 10th coronal section was collected for quantification for a total of 5 sections. Eight pre-assigned fields in each section in the ischemic boundary zone (IBZ) were photographed using a microscope (Leica, Heerbrugg, Germany). ImageJ software was used to quantify positive areas of bielschowsky silver and MBP in these eight locations of white matter bundles located in the IBZs (National Institutes of Health, Bethesda, MD). The percentages of bielschowsky silver and MBP positive areas were used to express the data.
Immunofluorescence
To avoid non-specific staining, slices were initially blocked with 10% donkey serum for 2 hours before the double immunofluorescence experiment. After blocking, the sections were then treated at 4°C overnight with primary antibodies of nestin1 (1:50; Abcam), DCX (1:50; Abcam) and BrdU (1:50; Abcam). After washing in PBS, the sections were incubated for 2 hours at room temperature with fluorescently labelled secondary antibodies (Invitrogen). Samples were counterstained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) for 5 min, then observed and photographed using a confocal laser scanning microscope (Leica SP8X) with a ×63 oil immersion lens.
Golgi-cox Staining
Golgi-Cox staining was used to determine dendritic spine density in rats following MCAO, as previously described[22]. In brief, 30 days following surgery, the fresh rat brain was taken without perfusion or fixation and immediately immersed in the Golgi-Cox solution at room temperature for two weeks. The brain was then placed in a 30% sucrose solution at 4°C in the dark for more than two days before being sliced into 100 m coronal pieces and stained with 75% ammonia solution and 1% sodium thiosulfate. Morphological analysis was carried out by randomly measuring 5 neurons for each sample.
Cell Culture And Characterization
Primary neural stem cells (NSCs) were isolated from foetal rat cortices at embryonic day 13.5 and cultivated as serum-free monolayers, as previously described. In brief, cells were seeded on poly-L-ornithine and fibronectin-coated dishes and grown in Dulbeccos' modified Eagle's/F12 medium (DMEM, Life Technologies, Darmstadt, Germany) supplemented with N2 supplement (Gibco, Karlsruhe, Germany), penicillin/streptomycin, L-glutamine, and sodium pyruvate. As mitogen, 10 ng/ml fibroblast growth factor (FGF2) was added. After the first passaging, homogenous NSCs were replated at 10,000 cell/cm2 and used in all tests until the fifth passage. To verify the homogeneity of NSC, immunocytochemistry was performed by fixing cells with 4% paraformaldehyde, stained for sex-determining region Y (SRY) box 2 (SOX2) (1:1000, R&D Systems, Minneapolis, USA) before incubated with secondary fluorescein-labelled antibody (1:200, Invitrogen). Additionally, all cells were double-stained with Hoechst 33324 (Life Technologies).
Cell Transfection
For stable transfection, rat-specific shRNAs targeting Rac1, Pak1 and a Luciferase shRNA were cloned in the lentiviral vector pFUGW-GFP[23] using standard protocols. The indicated sequences are as follows: Rac1: GCCTACTGATCAGTTACACAA; Pak1: CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTTG; Luciferase: CGTACGCGGAATACTTCGA; Viral particles were generated using standard protocols. Lentiviral constructs were transfected into HEK293FT cells (Invitrogen) using PolyJet transfection reagent (SignaGen, MD, USA). In short, the lentiviral constructs pCMV-VSVG, pCMV-dR8.2 and pFUGW-GFP-shRac1/shPak1/shLuciferase were cotransfected into a flask of 95% confluent HEK293FT cells. Cell culture media with viral particles were harvested at 72h post-transfection and were added to primary neural stem cells. The cells were continuously selected in the presence of puromycin (Sigma-Aldrich) to establish stable cells. The expression of green fluorescent protein (GFP) was observed under microscope 72 h later, and successful knockdown of Rac1 and Pak1 was confirmed by Western blot and quantitative PCR (qPCR).
Trans-well Migration Assay
The effect of CN04-A or SDF-1-induced cell migration of NSC were evaluated in vitro via trans-well migration assay. Cells were inoculated in modified Boyden chamber (CytoSelect, 8 µM pore size, Cell Biolabs, Inc., San diego, USA) according to the manufacturer’s protocol[24]. Briefly, NSCs were rapidly treated with Rac1, scrambled siRNA, or CN04-A for 48 hours, and then seeded in the upper chamber. Five-hundred µl medium containing 25 ng/ml of SDF-1 (Biosource, Camarillo, CA, USA) or 0.1% DMSO as negative control was added to the bottom chamber. The upper chamber was then sucked out, rinsed with PBS, fixed in 4 per cent neutral buffer formalin for 1 hour, stained with 0.5 per cent crystal violet and 10% methanol solution, and washed again with PBS. A cotton swab is then used to remove the unmigrated cells from the upper chamber. The ImageJ software was used to picture and quantify the size and number of colonies.
Co-immunoprecipitation (Co-IP) assay
NSCs were lysed with IP buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.1% sodium deoxycholate, 100 mm NaF, 5 mM MgCl2, 0.5 mM Na3VO4, 0.02% NaN3, 0.1 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride, 10 µg/mL aprotinin, and 1 µM pepstatin A). To eliminate debris, cell lysates were centrifuged at 22,000 g for 30 minutes. The supernatants, which included roughly 1 mg of total protein, were pre-cleared using agarose beads before being incubated with 1 µg of specific antibody overnight at 4°C with moderate mixing.The fractions were then incubated for 2 hours at 4°C with agitation with goat anti-mouse IgG conjugated with agarose. Centrifugation was used to collect both the agarose beads and the non-precipitated supernatant. The agarose beads were washed with IP buffer three times before being combined with two sample loading buffers. The sample was boiled for 5 min and subjected to the Western blot assay.
Western Blotting
Protein levels in the ipsilateral cerebral cortex and primary microglia cells were determined by using Western blots. The ipsilateral cerebral cortex was homogenized and lysed with RIPA buffer and the mixture of protease and phosphatase inhibitors (Abcam). The treated cells were then lysed using the Mammalian Cell Lysis kit (Sigma). The extracted proteins were subsequently separated with 10% SDS-polyacrylamide and electronically transferred to PVDF membranes (Millipore). The membranes were then blocked for 1 hour at room temperature with TBST containing 5% nonfat dry milk. The western blots were probed with primary antibodies recognizing the following proteins and further incubated with corresponding secondary antibodies (1:10000; Invitrogen): Rac1 (1:1000; MyBioSource); Pak1 (1:1000; Abnova); p38 (1:1000; AmyJet); β-catenin (GT1186, 1:1000; GeneTex); p-Pak1 (Ser144, 1:1000; Beyotime); p-p38 (Thr180, 1:1000; Chuntest); p-β-catenin (Thr41, 1:1000; Abcam); GTP-Rac1 (1:1000; Abcam); SDF-1 (1:1000; AmyJet); CXCL12 (1:1000; AmyJet ). Image J software (version 1.49) was used to evaluate protein expression levels adjusted to β-actin and GAPDH. Protein levels which have been phosphorylated were compared to protein levels overall.
Statistical analysis
SPSS (version 19.0; SPSS, Inc., Chicago, IL, USA) was used to analyze all data. The mean ± SEM of the values is used. The non-paired t-test was performed to examine the significance of differences between the two groups. P < 0.05 was determined to be statistically significant.