Reagents
Dulbecco's modified Eagle'medium-nutrient mixture F12 (DMEM-F12), fetal bovine serum (FBS), alamarBlue reagent, PageRuler plus prestained protein ladder and Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Accutase solution, radio immunoprecipitation assay (RIPA) lysis buffer, phosphatase inhibitor and protease inhibitor were purchased from Merck KGaA (Darmstadt, Germany). Bradford reagent and iScript Reverse Transcription SuperMix were purchased from Bio-Rad Laboratories (Hercules, CA, USA). Bovine serum albumin (BSA) was purchased from New England BioLabs (Ipswich, MA, USA). TMZ was provided by Tasly Group Co, Ltd (Jiangsu province, China).
Antibodies
Anti-NFIA primary antibodies was purchased from Thermo Fisher Scientific (Cat log no. PA5-52252, Waltham, MA, USA). An Anti- NF-κB p65 primary antibody was purchased from Thermo Fisher Scientific (Cat log no. 701079, Waltham, MA, USA). Anti-rabbit IgG was purchased from Abcam (Cat log no. ab171870, Cambridge, MA, USA) and used as a negative control. Horseradish peroxidase-conjugated goat anti-rabbit IgG (Cat log no. ab97051) and goat anti-mouse IgG were purchased from Abcam (Cat log no. ab205719, Cambridge, MA, USA) and used as secondary antibodies.
Gene expression analysis
Gene expression data was extracted from GEO datasets (Tso et al[15], GSE 68029, 2015 and Mao et al[16], GSE67089, 2015). Hierarchical bi-clustering was performed to analyze the expression of the targeting genes via Cluster 3.0. Euclidean distance and average linkage were used as similarity metric and clustering methods, respectively. The comparison of the relative gene expression between the naïve and resistant GBM cells was presented as fold-changes.
In vitro cell culture
GBM cell lines U87 was purchased from BeNa Culture Collection (Kunshan, China). Cells were cultured in DMEM-F12 with 10% vol FBS at 37˚C with 5% CO2. The medium was replaced every 2-3 days and cells were dissociated with accutase before seeded. The number of cells was measured by using cell counter with trypan blue and was seeded with a density of 106 cells/10 mL.
Inducing TMZ resistance in GBM cells
U87 cells were cultured in 6-well plates with DMEM-F12 containing 10% FBS at 37˚C with 5% CO2 overnight. Cells were treated with TMZ at a starting dose of 100 μM. Medium containing TMZ was replaced every 24 h for the first 5 days continuously. TMZ concentration was added every 2 weeks for 3 months and the maintenance dose was 500μM.
In vitro cell proliferation assay
Adhered GBM cells were dissociated into single cell suspension with accutase before using. Cell number was measured by using cell counter with trypan blue. Cells were seeded into 96 wells plate at a density of 1000 cells per well with 100μL fresh medium. Cell number was calculated by alamarBlue according to the manufacturer’s protocol at day 0, 2, 4, 6 and 8 after seeding.
In vitro cell viability assay
Single cell suspension was seed into 96 wells plate at a density of 2000 cells/100μL per well and cultured for 12 h at 37˚C with 5% CO2 then added 100μL of fresh medium containing TMZ at different amount. The cell number was measured by using alamarBlue according to the manufacturer’s instructions. IC50 was calculated with SPSS 19.0.
Quantitative RT-PCR (qRT-PCR)
Total RNA was prepared by using the RNeasy mini kit according to the manufacturer’s instructions. Concentration of RNA was determined by Nanodrop 2000. cDNA was synthesized by using iScript reverse transcription5 supermix for RT-qPCR according to the manufacturer’s protocol. qRT-PCR was performed by using StepOnePlus real-time PCR system with SYBR Select Master Mix (Applied Biosystems). GAPDH was used as an internal control. Running cycles for DNA amplification used in this study is described as below: 94°C for 2 min, 50 cycles of 94°C (30 s), 60°C (30 s), and 72°C (40 s). The sequences of the primers were shown as below: NFIA-forward: TAATCCAGGGCTCTGTGTCC; NFIA-reverse: CCTGCAGCTATTGGTGTCTG; NF-κB p65-forward: CCGCACCTCCACTCCATCC; NF-κB p65-reverse: ACATCAGCACCCAAGGACACC; GAPDH-forward: GAAGGTGAAGGTCGGAGTCA; GAPDH-reverse: TTGAGGTCAATGAAGGGGTC. Relative quantitation of cDNAs to GAPDH was determined via 2-ΔΔCtmethod.
Western blotting
Western blotting analysis was performed as described previously[4]. Cell lysates were prepared with RIPA buffer containing protease and phosphatase inhibitor cocktail on ice then then concentrations of protein were measured by using the Bradford method. 10ug/lane of protein were fractionated on NuPAGE Novex 4-12% Bis-Tris Protein gel (Invitrogen) and then transferred to PVDF membrane (Invitrogen). Membranes were blocked with 5% skimmed milk for 1h then incubated with the primary antibody overnight at 4°C then incubated with the secondary antibody at room temperature for 1h. Protein expression was visualized by using ECL methods according to the manufacturer’s instructions (GE Healthcare Life Sciences). β-actin served as a control.
Immunohistochemistry (IHC)
IHC was performed as previously described[4]. All glioma samples used in this study had been pathologically diagnosed and the recurrence was confirmed by computed tomography (CT) or magnetic resonance imaging (MRI). Nuclei were counterstained with hematoxylin. German immunohistochemical scoring (GIS) was used to measure the expression of NFIA.I Immunoreactivity score = positive cell score x staining intensity score. The positive cell score was calculated as below: 0, negative; 1, <10% positive; 2, 11-50%; 3, 51-80%; 4, >80%. Staining intensity score was graded as below: 0, negative; 1, weakly positive; 2, moderately positive; 3, strongly positive. Immunoreactivity score >3 was considered positive staining.
Lentivirus production and transduction
Lentivirus production and transduction was performed as mentioned in the previous study[4]. The lentivirus for shNFIA and NFIA overexpression were purchased from Genechem (Shanghai, China). The lentivirus infection was performed according to the manufacturer's protocol.
Luciferase reporter assay
After lentivirus infection, pre-treated 293T or U87 cells were seeded at a concentration of 106 cells per well in six-well plates. NF-κB p65 activity was determined by using the NF-κB Reporter kit (BPS Bioscience, Cat log no. 60614, San Diego, CA, USA). The attached cells were transfected with NF-κB reporter and negative control reporter for 24 h following the manufacturer's protocol. Normalized luciferase activity for NF-κB p65 reporter was measured as a ratio of firefly luminescence to Renilla luminescence. 5 replicates were used for each sample and the results were represented as mean ± SD.
Flow cytometry
Flow cytometry was performed as previously described[4]. The Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit was used to measure U87 cell apoptosis according to the manufacturer's protocol.
In vivo intracranial xenograft tumor model
All the usage of experimental animals in this study was adheres to the Animal Research: Reporting In Vivo Experiments (ARRIVE) guidelines. 6-week-old female nude mice cultured under specific pathogen free condition (provided by the Experimental Animal Centre of Xi’an Jiaotong University) were used for in vivo xenograft of GBM cells. Prepared GBM cell suspension (pre-transduced with shNT or shNFIA lentivirus) was diluted to the density of 1 × 105 cells in 2 μL PBS then implanted into the mice brains as previously described[4, 17]. 5 mice were used for each group. TMZ (50mg/kg/d) or DMSO was taken by tail vein injection after 7 days injection of glioma cells. Mice were monitored once a day until the following symptoms appeared: arched back, leg paralysis, unsteady gait or bodyweight loss for more than10%. When neuropathological symptoms developed, the mice were anaesthetized and sacrificed with overdose Ketamine (80mg/kg) and Xylazine (20mg/kg).
Statistical analysis
All the results in this study are presented as mean ± SD. Number of replicates is mentioned in the related figure legends. Statistical differences between 2 groups were evaluated by using 2-tailed t tests. Multiple groups were compared with one-way ANOVA followed by Dunnett’s posttest. Kaplan-Meier survival analysis was compared by log-rank analysis. All statistical analysis was performed with SPSS 19.0 or GraphPad Prism 6 software. Statistically significance was considered when P value was less than 0.05.