Cell culture
The NPC cell line TW01 is an established cell line derived from moderately differentiated keratinising NPC tissues, and was kindly provided by Prof. Chin-Tarng Lin, National Taiwan University, Taipei (20). TW01 cells were cultured with DMEM supplemented with 10% v/v foetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin. Poorly differentiated human NPC cell lines SUNE 5-8 F (highly tumorigenic and metastatic) and 6-10B (highly tumorigenic, but poorly metastatic) derived from the parental line SUNE-1, were obtained from the Prof. Qingling Zhang, Southern Medical University, Guangzhou China (21, 22). HK1, a well-differentiated squamous carcinoma line was obtained from the Queen Elizabeth Hospital, University of Hong Kong (23). C666-1 is an undifferentiated NPC cell line obtained from Prof. Maria L. Lung, Center for Nasopharyngeal Carcinoma Research, University of Hong Kong (24). These last four NPC cell lines were cultured in RPMI supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. All NPC cells were maintained in a humidified incubator with 10% CO2 at 37°C. Wild type mouse embryonic fibroblasts (MEFs) and triple knock-out foxo1/3/4-/- MEFs were kind gifts from Prof. Boudewijn Burgering, UMC, Utrecht, the Netherlands, and have been described previously (25). MEF cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) (Sigma Aldrich, Poole, UK) and supplemented with 10% (v/v) foetal calf serum (FCS) (First Link Ltd, Birmingham, UK), 100 Unit/ml penicillin/streptomycin (Sigma-Aldrich, UK) and 2 mM glutamine and maintained at 37°C in a humidified atmosphere containing 10% CO2.
siRNA mediated gene knockdown
For gene knockdown, cells were plated in at 60-70% confluency. The following day, cells were transfected with ON-TARGET plus siRNA smart pools (GE Dharmacon) targeting SIRT2 (L-004826-00-0005) using oligofectamine (Invitrogen, UK) according to the manufacturer’s protocol. Non-Targeting siRNA pool (GE Dharmacon; D-001210-01-05) was used as transfection control.
Sulforhodamine B colorimetric assay
A total of 1,000 NPC cells per well were seeded in a 96-wells plate. One day after seeding, NPC cells were treated with increasing concentrations of Lapatinib for 24 and 48 h. The cells were fixed with 40% trichloroacetic acid at 4°C for 1 h, washed 3 times with PBS and stained with 0.4% (w/v) sulforhodamine B (SRB) solution at room temperature for 1 h. Following the staining, the cells were washed 5 times with 1% acetic acid and air-dried overnight. The protein bound dye was dissolved in 10 mM Tris base solution and the absorbance was measured at 492 nm using a microplate reader (Sunrise, Tecan; Männedorf, Switzerland).
Clonogenic assay
A total of 2,000-10,000 cells were seeded into 6-well plates and incubated overnight. The cells were then treated for 72 h with varying concentrations of Lapatinib and SIRT inhibitor (SIRT-i). DMSO (Sigma-Aldrich,) was used as a vehicle and blank. The drug was removed and surviving cells were left to form colonies. After 1-2 weeks of incubation, colonies were fixed with 4% paraformaldehyde for 15 min at room temperature and then washed with PBS three times. Crystal violet (0.5% w/v) was used to stain the fixed cells for 30 min, following which the plates were washed with tap water. Plates were then left to dry overnight. Quantification was achieved by solubilising dye with 33% acetic acid and the absorbance was measured at 592 nm using Tecan Microplate reader.
Western blotting and antibodies
Western blotting was performed with whole cell extracts prepared by lysing cells with NP40 lysis buffer [1% NP40, 100 mmol/L NaCl, 20 mmol/L Tris-HCl (pH 7.4), 10 mmol/L NaF, 1 mmol/L Na orthovanadate, 30 mmol/L Na β-glycerophosphate, and protease inhibitors (“Complete” protease inhibitor mixture, as instructed by the manufacturer, Roche Applied Science)] on ice for 15 min. After incubation, the lysates were centrifuged at 13,000 × g for 10 min, and the supernatant was collected. Protein concentrations were determined using a BCA protein assay kit (ThermoFisher Scientific, Waltham, MA, USA). Ten micrograms of protein were size fractionated using SDS-PAGE and electro-transferred onto nitrocellulose membranes (BioRad, San Diego, CA, USA). Membranes were blocked in 5% (w/v) bovine serum albumin (BSA) in TBS plus 0.5% (v/v) Tween for 1 h at room temperature and then incubated with specific antibodies overnight at 4°C. The antibodies against EGFR, P-EGFR, ERBB2, P-ERBB2, ERBB3, P-ERBB3, JNK, P-JNK, p38, P-p38, c-Myc, p27Kip1, P-FOXO3 (T32), FOXO3, cyclin B1, P-AKT (S473), AKT and β-Tubulin were purchased from Cell Signalling Technology (New England Biolabs Ltd., Hitchin, UK). The antibody against FOXM1 (C-20) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Primary antibodies were detected using horseradish peroxidase-linked anti-mouse or anti-rabbit conjugates (Dako, Glostrup, Denmark) and visualized using the ECL detection system (Perkin Elmer, Beaconsfield, UK).
Co-Immunoprecipitation assay
NPC cell lysates were prepared in IP buffer (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris-HCl [pH 7.4], 10 mM NaF, 1 mM Na3VO4, 10 mM N-ethyl-amide (NEM) and protease inhibitors [Complete protease inhibitor cocktail; Roche, Lewes, UK]). The pre-cleared lysate was immunoprecipitated with the indicated antibodies and with protein A/G-sepharose for 4 h. After that, the fractionated supernatant was transferred to the new tube. Samples and incubated overnight with 0.5 µg of primary antibody-FOXO3 (sc-11351, Santa Cruz) (1;50), Anti-acetyl lysine (Cell-Signalling technology) or IgG negative control (2729, Cell-Signalling technology) (1;500) at 40C on a rotator. The supernatant was discarded on the following day and beads were washed three times with PBS. Samples were boiled with 2 × SDS sample buffer for 5 minutes at 100 °C and were analysed by SDS-PAGE followed by western blotting.
Gene expression analysis by RT-qPCR
Total mRNA was extracted from cell pellets using the RNeasy Mini Kit (Qiagen, UK) according to manufacturer’s instructions. The purity and concentration of mRNA samples were determined by measuring the spectrophotometric absorption at 260 nm and 280 nm using a NanoDrop ND-1000. Then, 2 µg of the extracted total RNA was used as a template for first strand cDNA synthesis reaction, The resulting first-strand cDNA was then used as template in the real-time PCR. Real time quantitative PCR (RT-qPCR) was performed on 100 ng of cDNA with SYBER-Green Master Mix (Applied BioSystems). All RT-qPCR assays were assayed in 96-well plates in the ABI PRISMâ 7900 HT Fast Real-time PCR System (Applied BioSystems) on a cycling program of 90°C for 10 min for enzyme activation followed by 40 cycles of denaturation and primer annealing/extension consisting of 95°C for 3s and 60°C for 30s respectively. The nonregulated ribosomal housekeeping gene, RPL19 was used as an internal control to normalize gene expression between samples. All samples were done in triplicates. Primer sequences used for RT-qPCR are,
RPL19-F: 5’GGTGCTTCCGATTCCAGAGT3’,
RPL19-R: 5’CCCATTCCCTGATCGCTTGA3’,
Erbb2-F: 5’GCTCTTTGAGGACAAGTATG3’,
Erbb2-R: 5’AAGATCTCTGTGAGACTTCG3’,
Egfr-F: 5’CTGTCGCAAAGTTTGTAATG3’,
Egfr-R: 5’GAATTTCTAGTTCTCGTGGG3’,
Foxo3-F: 5’CCGGACAAACGGCTCACT3’,
Foxo3-R: 5’GGCACACAGCGCACCAT3’,
Foxo4-F:5’AGGACAAGGGTGACAGCAAC3’,
Foxo4-R: 5’GGTTCAGCATCCACCAAGAG3’,
Foxo1-F: 5’AAGAGCGTGCCCTACTT-CAA3’,
Foxo1-R: 5’TCCTTCA-TTCTGCACTCGAA 3’.
Statistical data analysis
The results were represented as the means ± SEM of at least 3 separate experiments. For categorical variables, we used the analysis of variance (ANOVA) which was followed by a Bonferroni’s post-hoc test for multiple comparisons. Student’s t test was used to analyse the statistical significance of differences between the control groups and the experimental groups. The differences were considered as significant at p < 0.05. The GraphPad Prism 5.0 software (version 5.00 for Windows, GraphPad Software; San Diego, California, USA) was used for the statistical analyses. ImageJ software was used to analyse and compare the intensity of the protein bands obtained from Western blots.