Animal housing
Adult male Wistar rats, 2-2.5 months old weighing 200-300g, were used in this study (n=6). These mice had free access to food and water ad libitum and were housed under a 12-h light-dark cycle at a stable temperature and humidity-controlled room.
Isolation and identification of SSCs
First of all, the testis tissue sections were excised from healthy groups, and isolation of SSCs was conducted as previously described (18). Secondly, the immunocytochemistry method was performed to anatomically visualize the localization of the promyelocytic leukemia zinc finger protein (PLZF) in the SSCs derived colonies after 7 days of culturing. The protocol of this technique was also explained earlier (18).
Preparation and transfection of hsa-mir-106b plasmids
The pLV-miRNA vector, comprising hsa-mir-106b lentivirus and co-expressing GFP protein in infected E. coli BL21 was purchased from Biosettia Inc. (mir-p081, Biosettia, San Diego, CA, USA). Transfection of SSCs was done by 2.5 μg of the pLV-miRNA vector. For this reason, mouse SSCs (1.0 ×106) were seeded in a 6-well plate before transfection so that the cell density was around 70%-90%. Gently, 500 μl of culture medium and 7.5 μl of Lipofectamine3000 (Invitrogen, USA) solution were mixed and incubated for 10-15 minutes at room temperature. Meanwhile, 2.5 μg of the pLV-miRNA vector was added to 500 μl of the medium. Then, 250 ml of the produced solution was added to each well and the cells were incubated at 37 ° C for 2-4 days. In order to confirm the transfection efficiency and observe the expression of the GFP gene under a fluorescence microscope, the quantitative real-time reverse transcriptase PCR (qRT-PCR) technique was used. For this purpose, the sequences of forward and reverse primers, mir-106b, and U6 snRNA (as a reference gene) were downloaded from the www.ncbi.nlm.nih.gov/Gene website and designed using GeneRunner software (Table 1). The cDNA was synthesized according to the manufacturer’s protocols (Fermentas, USA) and the products were analyzed by electrophoresis in 1% agarose gel with a DNA ladder (1kb).
Table 1: Primers used for qRT-PCR analysis
Primer
|
Sequence (5'–3')
|
miR106b-f
miR106b-r
|
ACUGCAGUGCCAGCACTT
GGCAAAGTGCTTACAGTGC
|
Stem loop
|
GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAANNNNN
|
U6
|
AACTGGTGTCGTGGAGTC
|
Preparation and culture of mouse iPSCs
The mouse iPSC line was provided by Prof. Soleimani (Bonyakhte Stem Cells Technology, Research Center, and Tehran, Iran). iPSCs were generated from male NMRI mouse fibroblasts via the retroviral transfer of transcription factors Oct4 / Sox2 / Klf4 / c-Myc. The cells were used as positive control.
Design of study and hanging drop cell culture of the experimental groups
This study was designed based on four experimental groups, including the SSCs, SSCs with empty vector (without any miRNA gene, Mir control), SSCs infected with miR-106b (Induced SSCs), and iPSCs. We placed these experimental groups in the hanging drop culture, a simple technique that suspends media by gravity and surface tension to form 3D spheroids (19). The hanging drops were prepared by pipetting 50 μl of media containing 70% DMEM F12 (Gibco, UK), 10% FBS (Gibco, UK), and 20% methylcellulose (to increase the viscosity of the solution) into a 10 cm dish at a density of 80 cells/μl. The bottom of the Petri dish was filled with approximately 3-4 ml of dH20 to prevent drop evaporation. After that, the lid gently was inverted over the PBS-filled bottom chamber and incubated at 37°C/5% CO2/95% humidity for 48 h. The drops were monitored daily and incubated until the formation of aggregates. After 48 h in culture, they were transferred to a 96-well pre-coated with LM agarose. In each well, 170 μl of the 10% culture medium was then added, so that the final volume was 200 μl.
Evaluation of miR-106b and OSKMN genes expression level
The expression level of miR-106b and OSKMN genes as common pluripotent and stemness regulators were evaluated by real-time PCR. After 2 weeks of the hanging drop cell culture, the total RNA was extracted using the Trizol reagent from the experimental groups and then treated with DNase I (Fermentas, Germany) to eliminate genomic contamination. The cDNA synthesis was conducted by the RevertAidTM First-Strand cDNA Synthesis Kit (Fermentas, Germany) and oligo (dT) primers. Thereupon, primers of the OSKMN genes and β-actin gene (as an internal control) were designed for PCR and RT reactions by Primer-BLAST tool on the NCBI database (www.ncbi.nlm.nih.gov) and synthesized via a commercial company (CinnaGen, Iran) (Table 2). The Real-Time PCR techniques were performed on Applied Biosystems, StepOneTM thermal cycler (Applied Biosystems, USA), using Master Mix and SYBR Green I. The standard PCR conditions were started by a melting cycle of 5 min at 95 °C and as follows: 40 cycles of melting (30 s at 95 °C), annealing (30 s at 60 °C), and extension (30 s at 72 °C). The melting curve analysis confirmed the quality of the reactions and then the gene efficiency (logarithmic dilution series of cDNA from the samples) was specified with a standard curve. The comparative cycle threshold (CT) method (2−ΔΔCT) was used to examine the relative quantification of the target genes normalized against the reference gene. Then, the expressions of the target genes in studied groups were examined, compared with the gene expressions in iPSCs prior to transplantation.
Table 2: Primers used for real-time PCR analysis
Primer
|
Sequence (5'–3')
|
Sox2-f
Sox2-r
|
AGGGGAGAGAGAAAGAAAGGAG
AATATTTGGGGGGAAGCGGAG
|
Nanog-f
Nanog-r
|
TTATCCACTGAGCCATCTCACCA
CCACCTTTGGTCCCAGCATTCA
|
Klf4-f
Klf4-r
|
CCAACACACACGACTTCCC
CCACGACCTTCTTCCCCTCT
|
cMyc-f
cMyc-r
|
TAACTCGAGGAGGAGCTGGA
GCCAAGGTTGTGAGGTTAGG
|
Oct4-f
Oct4-r
|
TGATTGGCGATGTGAGTGAT
GGAGAAGTGGGTGGAGGAAG
|
β-actin-f
β-actin-r
|
TCAGAGCAAGAGAGGCATCC
GGTCATCTTCTCACGGTTGG
|
Bioinformatic analysis and data availability
First, the genes of signaling pathways regulating the pluripotency of stem cells (SPRPSCs) were downloaded from the NCBI BioSystems database (BSID: 1026136, https://www.ncbi.nlm.nih.gov/). Subsequently, the functional miRNA enrichment analysis of the genes was performed using the FunRich software (version 3.1.3) available for public access. Thereafter, we determined the potential genes which hsa-miR-106b-3p and hsa-miR-106b-5p would target by means of online tools and databases (http://www.targetscan.org/ and http://mirwalk.umm.uni-heidelberg.de/). Therefore, we generated a scalable Venn diagram to find common genes targeted by both arms of miR-106b. The common target genes and the genes of SPRPSCs ultimately were represented in a Matrix table (pair-wise comparison). Besides, we showed a Heatmap image of the common targets based on the human proteome map of the FunRich. To predict and appraise the existing protein‑protein interaction (PPI) network among proteins of the common target genes distinguished in the Venn diagram, we used a bioinformatics tool, the Search Tool for the Retrieval of Interacting Genes (STRING 11.0, http://string-db.org/) database.
Statistical analysis
Gene expression analysis was performed using a one-way analysis of variance and Tukey post-test using GraphPad Prism version 8.0.0 for Windows (Graph Pad Software, San Diego, CA). Error bars represent ±SD (standard deviation), as well as the p-values <0.05 were considered statistically significant.