Specimens and cell lines
In total, 89 BC tissue specimens and 10 adjacent normal paired tissues were obtained from individuals who had undergone a radical cystectomy at the Second Affiliated Hospital of Nanchang University from January 2014 to December 2019. No patients had received chemotherapy or radiotherapy before surgery. Written informed consent was obtained from all patients according to ethical standards, and the study was approved by the Ethics Committee and Institutional Review Board of the Second Affiliated Hospital of Nanchang University. The histopathology of these tissue samples was determined and confirmed by two pathologists according to the criteria of the World Health Organization and the Nevin staging system.
The bladder cancer lines T24 and 5637 cells were cultured in RPMI 1640 (Gibco, Grand Island, NY, USA) with 10% fetal calf serum (FCS; Gibco). J82 cells were maintained in minimum essential medium (MEM) (Gibco) with 10% FCS. All cells were maintained at 37 °C in a 5% CO2 incubator.
Immunohistochemistry (IHC)
The expression of CAB39 was examinated by IHC assay on paraffin-embedded tissue sections. Anti-CAB39(ab51132, 1:100 dilution), anti-E-cadherin(ab1614, 5μg/ml dilution), and anti-N-cadherin(ab207608, 1:500 dilution) were purchased from Abcam (Cambridge, MA, USA). Tissue sections were prepared and stained as previously described [26]. Then, images were taken with a tissue chip scanner and analyzed using paired software. Histochemistry score (H-score) based on the percentage of positive cells and degree of staining was computed to quantify CAB39 expression as previously described by Yeo et al.[27]. Patients were classified into two groups (low and high expression) based on the overall scores.
RNA extraction and quantitative real-time PCR (qPCR) analysis
Total RNA samples from cultured cells and tissues were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) The forward and reverse primer sequences for CAB39 were 5'GCATTTGCCACATTCAAGGATT3' and 5'GCTGCGTCTTGTTAGGATTGG3', respectively. Quantitative real-time PCR (qRT-PCR) was performed on a BioRad CFX96 real-time PCR machine (BioRad, Hercules, CA, USA) as described previously[26]. Glyceraldehyde-3 phosphate dehydrogenase(GAPDH) was used as the housekeeping gene for internal quantitative control. The concrete setups were performed as we described previously.
Western blot analysis
Western blot was performed as previously described[26] e using Anti-CAB39(ab51132, Abcam, Cambridge, MA, USA, 1:2000 dilution), Anti-E-cadherin(ab1614, Abcam, Cambridge, MA, USA, 1:1000 dilution), Anti-N-cadherin(ab207608, Abcam, Cambridge, MA, USA, 1:1000 dilution) and Anti- NF-kB (ab86299, Abcam, Cambridge, MA, USA, 1:4000 dilution). Anti-β-actin (Servicebio, Wuhan, China, Cat. GB12001) was hired as an endogenous control. The density value of each sample was normalized to its β-actin density value to get its relative quantity value.
Lentivirus-mediated RNA interference (RNAi)
Target cells were cultured with a good growth status, and experimental conditions were designed according to experimental results of lentiviral infection. T24 and 5637 cells were infected with a lentivirus carrying a CAB39-knockdown (KD) plasmid (CAB39-KD-1 or CAB39-KD-2) or a control plasmid (GV248, Shanghai Genechem, Shanghai, China) at the good growth status. To silence CAB39 two target sequences :5’TCACACAATTGGTGTTGAA’3 which named CAB39-KD-1 and 5’GGAGCTCTTATGGTCTATG’3 which named CAB39-KD-2 were cloned. The target sequence for the control plasmid was 5’TTCTCCGAACGTGTCACGT’3. At 48 h after infection, the lentivirus carrying a copy of the green fluorescent protein (GFP) and the infection efficiency were assessed by florescence microscopy based on the numbers of GFP-expressing cells. CAB39 gene and protein expressions in infected cells were tested by the qRT-PCR and Western blotting.
Functional experiments
Wound healing assay, matrigel invasion assay and cell counting kit-8 (CCK-8) assay, which were used to analyze the invasion, migration, and proliferation of BC cells, were performed as previously reported [26].
Gene Set Enrichment Analysis (GSEA)
The datasets of CAB39 mRNA expression in BC samples analyzed by microarray were obtained from TCGA-BC for Cancer Genomics. Additional ethical approval was not required for downloading these data, for TCGA was publicly available database. Subsequently, GSEA was performed using these downloaded datasets to find target genes up- or down-regulated by CAB39 in BC[28]. It was considered statistically significant when statistical P value < 0.01 and false discovery rate (FDR) q < 0.05.
Animal experiments
Animal work was performed in accordance with a protocol approved by the Second Affiliated Hospital of Nanchang University Animal Care and Use Committee (Jiangxi, China). BALB/c female nude mouse at 6~7 weeks old were purchased from LingChang Bio-Technique (Shanghai, China) and subcutaneously injected with 2.5 x 106 of T24 cells with control or CAB39 shRNA (CAB39-KD-1) in a 50% MatrigelTM matrix (BD Co.). The tumor size was measured weekly in a blinded manner with calipers, and the tumor volume was calculated using the following formula: tumor volume = (4/3) x (L/2) (W/2)2, where L is the length and W the width. Results are presented as the mean ± standard error (SE) for each experimental group.
Statistic analysis
Data were expressed as mean ± standard deviation (SD), and all statistical analyses were performed using SPSS software version 20.0 (IBM SPSS Inc, Chicago, IL, USA). Differences of CAB39 expression between different groups were statistically analyzed using the t-test, while the chi-square test and Fisher,s exact test were used to analyze the relationship between CAB39 expression and the clinicopathological characteristics, and Kaplan-Meier was used to plot the survival curves. Comparisons were performed by two-sided independent Student’s test. Statistical significance was accepted when a P value is less than 0.05.