Bacterial isolates and growth condition
A total of 280 non-duplicate E. faecalis and 122 non-duplicate E. faecium strains were isolated from individual patients at Shenzhen Nanshan People’s Hospital from 2011-2015. Bacterial isolates were determined by standard methods using a VITEK 2 system (Biomérieux, Marcy l’Etoile, France). E. faecalis ATCC29212 and OG1RF (ATCC 47077) were tested as quality control strains. The isolates were cultured in TSB (Oxoid, Basingstoke, UK) at 37°C with a shaker at 220 rpm. The antimicrobials telithromycin (TEL), erythromycin (ERY), ampicillin (AMP), vancomycin (VAN), tetracycline (TET), doxycycline (DOX), minocycline (MIN), ciprofloxacin (CIP), nitrofurantoin (NIT), linezolid (LZD), tedizolid (TED) and tetracycline (TEC) were purchased from MCE (Princeton, NJ).
All procedures involving human participants were approved by the ethics committee of Shenzhen Nanshan People’s Hospital, in accordance with the ethical standards of Shenzhen University and the 1964 Helsinki declaration and its later amendments, or comparable ethical standards. For this type of study, formal consent is not required.
Antimicrobials susceptibility testing
Antimicrobial susceptibilities of enterococcus to a several clinical antibiotics, including TEL, ERY, AMP, VAN, TET, DOX, MIN, CIP, NIT, LZD, TED and TEC were tested
with the VITEK 2 system. The minimum inhibitory concentration (MIC) of AMP, VAN, TEL and ERY were identified by the broth macrodilution method according to the CLSI guidelines. As the breakpoint of TEL against enterococci have not been established, we referred to the value of TEL against Staphylococcus aureus (MIC ≤ 1 μg/mL, 2 μg/mL, ≥ 4 μg/mL) based on the 2019 CLSI guidelines. We employed five MIC levels for TEL in the antimicrobial susceptibility analysis MIC ≤ 1, 2, 4, ≥ 8 μg/mL.
PCR analyses
DNA was extracted from all clinical enterococcal isolates in lysis buffer and as templates for PCR according to the manufacturer’s instructions (Takara Bio Inc., Japan). All of the microbial DNA served as templates were stored at -20◦ C. PCR analysis was performed to detect ermA, ermB, and ermC genes as described previously. The primer pairs used for PCR amplification were as follows: ermA: sense, 5'- TCTAAAAAGCATGTAAAAGAAA-3' and antisense 5'- CGATACTTTTTGTAGTCCTTC-3'; ermB: sense, 5'-CCGTTTACGAAATTGGAACAGGTAAAGGGC-3' and antisense 5'-GAATCGAGACTTGAGTGTGC-3'; ermC: sense, 5'-GCTAATATTGTTTAAATCGTCAATTCC-3' and antisense 5'- GGATCAGGAAAAGGACATTTTAC -3'.
Multilocus sequence typing
MLST was performed to analyze the genotypes of the enterococcal isolates. Seven pairs of housekeeping genes: gdh, gyd, pstS, gki, aroE, xpt and yqiL for E. faecalis, and atpA, ddl, gdh, purK, gyd, pstS and adk for E. faecium were amplified by PCR. The purified PCR products were sequenced, and results were submitted to the MLST database (http://efaecalis.mlst.net/ and http://efaecium.mlst.net/ ) for comparison, and the sequence types (STs) of enterococci were determined. The primer pairs used for PCR amplification as listed in Table S4 and Table S5 have been described previously [33].
Inhibition and eradication of E. faecalis biofilms
As previously described [34], the E. faecalis isolates were diluted 1:200 and cultivated in 200 μl tryptic soy broth (TSB) medium at 37 °C, and inoculated into 96 polystyrene microtiter plates with TSBG (TSB+0.5% glucose) containing the indicated concentrations of telithromycin. After incubation for 24 hours, biofilm biomasses were stained with crystal violet and stained biofilms were detected with an optical density (OD570). For eradication assays of established biofilms, the E. faecalis isolates were cultivated in tryptic soy broth (TSB) medium at 37 °C for 24h to form matured biofilms, and then treated with antimicrobials (8× MIC) for 48h with the medium replaced daily, the biofilm biomasses were stained and detected. The results were collected from three independent experiments.
Statistical analysis
Statistical analyses were performed with the SPSS software (version 19.0) and GraphPad Prism software (version 5.0). Results are showed as mean ± SD. The p-value <0.05 was regarded as statistically significant.