Animal Model: we used transgenic mice of the “four core genotypes” mouse model in which the Sry (testicle determining) gene is inherited independently of the Y chromosome. This mouse model (Figure 1) combines a deletion of the testis-determining Sry gene from the Y chromosome (Y-) and the subsequent insertion of a Sry transgene into an autosome. Sry gene deletion in XY mice (XY-) yields a female phenotype (ovaries). When the Sry transgene is inserted into an autosome of these mice, they have testes and are fully fertile (XY-Sry). The Y- chromosome and the Sry transgene segregate independently, and thus four types of offspring are produced by breeding XY-Sry males with XX females: XX and XY- females (without Sry on the Y chromosome) and XX-Sry and XY-Sry male mice (both with Sry in an autosome). All individuals possessing the Sry transgene develop testes and have a male external phenotype regardless of their SCC, while individuals lacking the transgene have ovaries and external female secondary sex characteristics. Male and female are defined here according to the gonadal phenotype. Throughout the text, we will refer to XX and XY- as XX-females and XY-females, and to XXSry and XY-Sry as XX-male and XY male mice respectively. By comparing these genotypes, it is possible to segregate the role of a) SCC (comparing mice with the same gonadal type but with different SCC: XX vs. XY) b) gonadal sex (males vs. females regardless of SCC), and c) the interaction of SCC and gonadal sex.
-please insert figure 1 around here-
MF1 transgenic mice, kindly provided by Dr. Paul Burgoyne from the Medical Research Council National Institute for Medical Research, UK, were born and reared in the breeding facilities at the Instituto Ferreyra (Córdoba, Argentina).
All experimental protocols were approved by the appropriate animal care and use committees at our institute, following the National Institutes of Health guidelines for the care and use of laboratory animals (CICUAL Resolution 023-2018A). Genotyping was performed as previously described in Caeiro et al., 2011 [5].
Gonadectomy Adult male and female mice were anesthetized with ketamine/xylazine mixture (ip, xylazine, 1 mg/kg, König and ketamine 162 mg/kg Holliday-Scott, Argentina). A bilateral incision was made in the scrotum region for male mice and just below the rib cage in female mice in order to be able to perform bilateral gonadectomy. Afterwards, the muscle layer and the incision were sutured in place [5].
Kidney microdissection, tissue collection, RNA extraction and gene expression studies
As previously describe in Dadam et al., 2017 [9] longitudinal renal sample sections of 1600 μm were excised from the frozen kidney, and medulla punches were immediately taken with a stainless-steel punch (inner diameter 1.5 mm). RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) as directed by the manufacturer with some modifications: RNA precipitation with isopropanol was performed overnight at -20ºC. The RNA was treated with DNase (Fermentas), quantified using a NanoDrop 2000 UV-Vis spectrophotometer and then reverse-transcribed into cDNA (enzyme RTM-MLV – Promega). Kidney Avpr2 levels were determined with the Step One Real-Time equipment (Applied Biosystems).
Calculations of Relative Gene Expression
The relative quantification of Avpr2 was determined by the ΔΔCt method, in which the fold change of mRNA content in the unknown sample relative to the control group is determined by 2-ΔΔCt (ΔΔCt=ΔCtunknown – ΔCtcontrol). For each sample, the Ct was determined and normalized to the average of the Gapdh housekeeping gene. All samples were run in duplicate with the average CT used for each sample. The Ct of the calibrator group (the mean Ct of the MF1 male mice for Avpr2) was then subtracted from each sample to give a Ct value. Relative quantifications of the target gene were normalized to wild-type MF1 male mice. Data are presented as mRNA expression relative to the control calibrator group.
Chronic catheterization for blood pressure recordings and drug infusions
Under urethane anesthesia (1,5mg/kg), mice were surgically instrumented with intra-arterial catheters for the direct measurement of arterial pressure, and jugular vein catheters for drug administration [5]. A middle incision was made in the neck and end-heated 9 and 5 mm Micro-Renathane® tubing (MRE25, Braintree Sci., Boston, MA) welded to a silastic catheter (Dow Corning, 0.020 I.D. x 0.037 O.D.) was inserted into the left carotid artery and jugular vein, respectively. The cannulas were filled with sterile heparinized saline (50 U/mL) to prevent clotting. After surgery, the arterial catheter was connected to the blood pressure transducer coupled to a data acquisition system (Power Laboratory, ADI instruments), and the venous catheter was coupled to a pump for small volume infusion (Brown adapted pump for small volume infusions).
Experimental design
We aimed to analyze whether the differences between males and females in anti-diuretic and pressor dimorphic vasopressin responses previously reported by other authors [12, 10, 16] and in which an activational hormonal effect has already been described [8, 11, 17], may also be modulated by the organizational hormonal and/or the SCC effects. To evaluate the role of SCC and organizational hormonal effects, 60-day old adult mice of the four genotypes were gonadectomized (to remove activational hormonal effects) and were studied 42-45 days post gonadectomy. Comparing gonadal males and females after gonadectomy makes it possible to evaluate long-lasting differences in the phenotype due to organizational hormonal effects, while comparing mice with the same gonadal type but with different SCC (XX versus XY) makes it possible to determine whether genes residing in the SCC differentially influence sexually dimorphic traits (Figure 1).
Participation of SCC and organizational hormonal effect in the antidiuretic vasopressinergic response
Although in vitro studies suggest that the AVPR2 gene from human fibroblasts may escape X inactivation [6], to date there is no clear evidence indicating that the Avpr2 gene is capable of escaping this inactivation at renal level, which might thus explain, at least in part, the sex differences in vasopressinergic antidiuretic phenotype. If Avpr2 (involved in the antidiuretic effects of AVP) were to escape from X inactivation at kidney level (as demonstrated in fibroblasts in in vitro studies by Carrel and Willard), mice with two XX sex chromosomes may show not only increased mRNA Avpr2 levels compared to XY mice, but may also show functional sex differences in AVP antidiuretic effects, potentially contributing to sex differences in traits (sex-biased genes).
To investigate the potential physiological implications of the sex chromosome, complement and organizational hormonal effects on sex difference on the V2R antidiuretic response, we evaluated in gonadectomized mice of the four-core genotype mouse model urine osmolality induced by AVP V2R agonist desmopressin as well as Aprv2 mRNA kidney levels (by real-time PCR)
-Experiment N° 1. To analyze the effect of V2R agonist (desmopressin) administration on urinary osmolality, 42 days after gonadectomy, saline solution was injected and the animals were then placed in individual metabolic cages. After 4 hours, the urine was collected, and the animals returned to their accommodation cages. 24 hours later, the animals were injected subcutaneously with the desmopressin (1 mg/kg) and were housed during the following 4 hours in individual metabolic cages with no access to food or water. After this period, urine samples were obtained, and the mice were reintroduced into their standard housing cages. Urine samples were stored at -20°C until subsequent determination of osmolarity (Vapro Osmometer).
-Experiment N° 2. 45 days after gonadectomy, mice from a different group from that used in experiment N° 1 were euthanized by decapitation and the left kidneys were immediately excised and stored at -80°C for Avpr2 mRNA determination. Kidney tissue was rapidly dissected and homogenized for Avpr2 RNA isolation and determination by real time pcr. Primer sequences can be found in Table 1.
TABLE 1. Primer pairs for Avpr2 and Gapdh mRNAs
Gene
|
GenBank access number
|
Primer forward 5´- 3´
|
Primer reverse 5´- 3´
|
Product size(bp)
|
Annealing temp. (◦C)
|
Avpr2
Gapdh
|
NM_019404.2
NM_008084.2
|
TTGGCTCCTTTGTTGCCAGA
AGTGCCAGCCTCGTCCCGTAG
|
CCAAGTGCCTCTGTTGCCTA
GTGCCGTTGAATTTGCCGTGAGTG
|
85
196
|
60°C
66°C
|
-Insert table 1 about here-
Modulatory effect of the SCC and organizational hormonal factor on the vasopressinergic pressor response
Taking into account previous studies indicating sexual differences in pressor response to vasopressin infusion in intact animals [16], as well as the effect of gonadectomy and hormonal replacement on the pressor response (activational hormonal effect), we evaluated (in the absence of hormonal activation modulation) the effect of the organizational hormonal factor and SCC on the pressor response induced by a sustained infusion of vasopressin.
- Experiment No. 3. To assess the effect of sustained vasopressin infusion on the pressor dimorphic response, 45 days after gonadectomy mice were anesthetized with urethane (1.5 g/kg). Once the carotid artery and jugular vein were cannulated, the arterial catheter was coupled to a data acquisition system (Power Laboratory, ADI instruments) and the venous catheter to a Braun calibrated pump modified for infusion of small volumes. As the blood pressure recordings were stabilized, the basal levels were recorded as well as those resulting from the continuous infusion of vasopressin for 30 minutes (vasopressin 0.2 IU/ml, infusion volume 100 μl). Changes in blood pressure and heart rate were recorded and analyzed.
The percentage changes in mean, systolic and diastolic arterial pressure as well as the changes in heart rate were in each case obtained by the subtraction of the values at the different time points from the baseline values (delta change in the variables); then divide by the baseline values and finally multiplied the result by 100.
Statistical analysis
The data resulting from mRNA Avpr2 analysis were analyzed using a two-way ANOVA considering the organizational effect-sex (males vs. females) and the CCS (XX vs. XY) as independent factors, while in osmolarity data, organizational effect-sex (Males vs. Females), CCS (XX vs. XY) and treatment (saline vs desmopressin) were included as factors for the three-way ANOVA analysis.
Percentage changes in mean, systolic and diastolic arterial pressure and heart rate were subjected to a 2-way mixed ANOVA with repeated measures. Organizational sex (male/female) and SCC (XY/XX) were considered as independent factors. The loci of significant interactions or significant main effects were further analyzed using the LSD post-hoc test (type I error probability was set at 0.05). Results were expressed as group mean (M) ± standard error (SE).