High-Performance Liquid Chromatography Electrospray Ionization Mass Spectrometer (HPLC-ESI-MS) Analysis SCIEX ExionLC AD system (SCIEX, Foster City, CA, USA) equipped with a solvent delivery system, a degasser, an autosampler, a column oven, and a controller was used for HPLC-ESI-MS analysis. After decocting BSTL formula pieces, the liquid was diluted 100 times, filtered, and formed the sample compounds. The separation of the compounds was performed on a Waters ACQUITY UPLC HSS T3 (2.1 × 100 mm, 1.8 μm) at 40°C, using water (A) and acetonitrile (B) containing 0.05% formic acid as the mobile phase, with a flow-rate of 0.3 ml/min. The substances were ionized in the mass spectrometer's electrospray ionization (ESI) ion source and were detected in the selected ion recording (SIR) mode. The negative and positive ESI mode of mass spectra was acquired using the X500R Q-TOF system with a Twin Spray source (SCIEX, Foster City, CA, USA). The spectra for TOF-MS and TOF-MS/MS analysis covered the m/z ranges of 100-1,500 Da and 50-1,500 Da. SCIEX OS Software™ 2.0 (SCIEX, Foster City, CA, USA) was used to analyze the data.
Animals and Treatment All animal experiments were carried out in accordance with the protocol authorized by the Ethics Committee of Beijing University of Chinese Medicine (BUCM-4-2020121804-4173). Male db/db mice and wild-type m/m mice (6 weeks of age) were purchased from Cavens Biogle Model Animal Research Co., Ltd. (certificate number: SCXK2016-0010). All mice were housed in Beijing University of Chinese Medicine's pathogen-free animal facility. The mice were housed in an environment with a 12/12 h light cycle, a humidity level of 60%, a temperature range of 22–24 °C, and unrestricted access to food and drink. After 2 weeks of adaptive feeding, the blood glucose levels of the mice were randomly measured, and two consecutive readings over 16.7 mmol/L were considered to indicate the successful establishment of the model; db/db mice that met this criterion were used for further research. Then, db/db mice were randomly divided into the model group (db/db, n=8) or BSTL group (db/db+B, n=8) using the random number approach, and the m/m mice were placed in the nondiabetic control group (con, n=8). The mice in the BSTL group were given BSTL by intragastric administration, and the BSTL extract was provided by the pharmacy of Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, as reported in our previous study (22). The dosage of the crude BSTL drug that was administered to the mice was 16.5 g/kg/d; this dosage represented the regular dosage given to human adults. The mice in the control and model groups were given the same volume of distilled water. Body weight and random blood glucose levels in tail blood were tested every 2 weeks. In the case of water supplied only, the 8 h urine volume of mice was collected to evaluate the urinary albumin level every 4 weeks. The mice were killed after 12 weeks of treatment. Serum was collected, and kidneys were harvested for further analysis.
Preparation of Drug-Containing Serum Forty male Sprague‒Dawley (SD) rats (8 weeks of age and weighing 200 ± 30 g) were purchased from Beijing Huafukang Biotechnology Co., Ltd., and after one week of adaptive feeding, all the SD rats were randomly assigned to either the BSTL or blank groups, with 20 rats in each group. The rats in the BSTL group were given BSTL at a dosage of 36.6 g/kg/d and the rats in the blank group were given an equal volume of distilled water for 7 consecutive days. Then, the rats were anaesthetized with 1% pentobarbital sodium at a dose of 40 mg/kg, and 5-8 ml of blood was collected from the abdominal aorta of each rat. Serum samples from the same group were pooled after being centrifuged at 3,000 rpm for 10 minutes. After incubation 30 minutes in a 56 °C water bath, the serum was filtered, rebottled into 1.5ml sterile centrifuge tubes, and stored at -20 °C.
Cell Culture and Treatment Mouse podocyte clone-5 (MPC5) cells were donated by Prof. Weijing Liu (Dongzhimen Hospital, Beijing University of Traditional Chinese Medicine, China). Podocytes were cultured at 33 °C in medium that consisted of Roswell Park Memorial Institute (RPMI) 1640 medium (11879020/11875093, Gibco, NY, USA) supplemented with 10% foetal bovine serum (10099-141, Gibco), 100 μg/mL streptomycin, 100 U/mL penicillin G (V900929, Sigma, MO, USA), and 100 U/mL recombinant murine interferon (IFN)-γ (315-05-20, PeproTech, NJ, USA) to facilitate proliferation. Then, the podocytes were cultured at 37 °C for 10-14 days in RPMI 1640 medium without IFN-γ to facilitate cell differentiation. The podocytes were used for the in vitro experiment when the confluence was approximately 80%. The differentiated cells were stimulated for 48 h with normal glucose (NG, 5.5 mM), HG (HG, 30 mM), and BSTL (H+B, 30 mM glucose+BSTL drug-containing serum). All experimental results were verified in at least three independent podocyte cultures.
Biochemical Indicator Measurements A mouse albumin ELISA kit (ab108792, Abcam, OR, USA) and creatinine assay kit (C011-2-1) were used to measure the urinary albumin and urine creatinine levels, and then, the results were used to calculate the urinary albumin/creatinine ratio (UACR). Scr, blood urea nitrogen (BUN), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels were measured with the creatinine assay kit (C011-2-1), urea assay kit (C013-1-1), ALT assay kit (C009-2-1) and AST assay kit (C010-2-1) from Nanjing Jiancheng Biotechnology Co., Ltd. (JiangSu, China) according to the manufacturer’s instructions.
Renal Histological Examination Kidney samples were fixed with 4% paraformaldehyde and incubated at 4 °C for 72 h. The process of dehydration was carried out by a completely automated closed tissue dewatering machine according to standard procedures. Then, the samples were embedded in paraffin and cut into 2-3-μm-thick sections. Haematoxylin and eosin (HE), periodic acid-Schiff (PAS), and Masson staining were performed by the Department of Pathology, Beijing Hospital of Traditional Chinese Medicine, Capital Medical University. The slides were scanned and viewed with a Leica (Aperio CS2, Germany). At least ten randomly chosen fields for each mouse were evaluated under the microscope and analysed with Image-Pro Plus 6.0 software.
Immunohistochemical (IHC) Staining Paraffin-embedded kidney sections were incubated at 60 °C for 60 min, deparaffined with xylene three times for 15 min each, hydrated with gradient ethanol solution for 5 min each, and finally immersed in deionized water. Following a 20 min incubation at 95 °C with an antigen retrieval solution for antigen retrieval, the sections were let to cool naturally to room temperature. The endogenous peroxidase activity was quenched by incubation with 3% H2O2 at room temperature for 10 min. The sections were then blocked with goat serum (ZLI-9056, ZSBIO company, Beijing, China) at 37 °C for 30 min, followed by incubation with anti-nephrin (1:2000, ab216341, Abcam), anti-podocin (1:1000, ab50339, Abcam) and anti-cleaved caspase-3 (1:400, 19677-1-AP, Proteintech, Wuhan, China) antibodies overnight at 4 °C. The sections were then washed in phosphate-buffered saline (PBS), treated for 20 minutes at room temperature with horseradish peroxidase-conjugated anti-rabbit secondary antibody (PV-9001, ZSBIO business), and colour development was performed by incubating with diaminobenzidine (DAB, ZLI-9018, ZSBIO company). Finally, the nuclei were stained with haematoxylin. At least five randomly chosen fields for each sample were evaluated under the microscope and analysed with Image-Pro Plus 6.0 software.
Transmission Electron Microscopy (TEM) The mouse kidneys were cut into rectangular strips with a volume of approximately 1 mm3, fixed in 2.5% glutaraldehyde solution at 4 °C for 4 h, and washed three times with 0.1 mol/L phosphate buffer for 15 min each. Then the samples were fixed with 1% citrate solution for 2 h, washed three times with 0.1 mol/L phosphate buffer again, and dehydrated in a series of ethanol solutions (15 minutes each in 30%, 50%, 70%, 90%, 95% and 100% ethanol) followed by 100% acetone before hardening with epoxy resin (Epon) for 9 h. The samples were cut into 50-70-nm-thick ultrathin sections by a Reichert-Jung Ultracut S Ultramicrotome (Leica EM UC7, Germany). Then, the sections were stained with 2% uranyl acetate and lead citrate and observed with high-resolution TEM (JEM-1400 Plus, Japan).
Immunofluorescence Assay Paraffin-embedded kidney sections were deparaffinized and hydrated, and antigens were retrieved as described for IHC staining. Then, the sections were permeabilized by incubation with 0.3% phosphate-buffered solution (PBST) for 10 min, followed by incubation with 3% donkey serum for 30 min at 37 °C. The sections were then incubated with a mixture of rabbit anti-phospho-adenosine monophosphate-activated protein kinase alpha (p-AMPKα, 1:100, AF3423, Affinity, NJ, USA) antibody and mouse anti-synaptopodin (1:200, sc515842, Santa Cruz Biotechnology, CA, USA) antibody overnight at 4 °C. After washing with PBS, the sections were stained with a mixture of Alexa Fluor 488-conjugated donkey anti-mouse IgG (1:2000, A21206, Invitrogen, PA, USA) and Alexa Fluor 594-conjugated donkey anti-rabbit IgG (1:2000, A32754, Invitrogen) as the secondary antibodies at 37 °C for 60 min. The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, ZL1-9557, ZSBIO company). In vitro, podocytes were cultured in 24-well plates and treated with different media (NG, HG, HG+B) for 48 h. After fixation with 4% paraformaldehyde, the cells were permeabilized with 0.3% Triton X-100 and blocked with 3% donkey serum. Then, the cells were stained with a rabbit anti-phospho-AMPKα antibody or mouse anti-translocase of outer mitochondrial membrane 20 homologue antibody (TOM20, 1:200, sc17764, Santa Cruz Biotechnology) overnight at 4 °C. The podocyte slides were stained with a mixture of Alexa Fluor 488-conjguated donkey anti-mouse IgG (1:2000) or Alexa Fluor 594-conjguated donkey anti-rabbit IgG (1:2000) as secondary antibodies at 37 °C for 60 min, and then, the nuclei were counterstained with DAPI. A fluorescence microscope (A1 HAL 100, ZEISS Scope, Germany) was used to observe the slides and capture microscopic images, and Image-Pro Plus 6.0 software was used to analyse and quantify the data.
Phalloidin Staining Podocytes were cultured, treated, fixed, permeabilized, and blocked as described for the immunofluorescence assay. Then, podocytes were incubated with phalloidin (1:5000, P5282, Sigma) in the dark for 40 min at 37 °C, and the nuclei were counterstained with DAPI. The cells were observed and microscopic images were recorded by fluorescence microscopy (A1 HAL 100, ZEISS Scope, Germany).
MitoTracker Staining Podocytes were cultured and treated as described for the immunofluorescence assay. Subsequently, the cells were stained with MitoTracker red (1:2000, 8778P, CST, MA, USA) following the manufacturer’s instructions. Fluorescence images were captured with a confocal microscope (DCM-3D, Leica, Germany).
Terminal Deoxynucleotidyl Transferase-Mediated dUTP-biotin Nick end Labelling (TUNEL) Analysis The DeadEndTM Colorimetric TUNEL System (G7130/G7160, Promega, WI, USA) was used to identify apoptotic glomerular cells in vivo. Paraffin-embedded kidney sections were deparaffinized and hydrated as described for IHC staining. Then, the sections were treated with proteinase K for 15 min, washed with PBS, and fixed with 4% paraformaldehyde, followed by equilibration for 10 min at room temperature. The sections were incubated with r-terminal deoxynucleotidyl transferase (rTdT) reaction mixture for 1 h at 37 °C and immersed in 2X saline sodium citrate (SSC) for 15 min at room temperature. After washing with PBS, the sections were incubated with 3% hydrogen peroxide for 5 min at room temperature, incubated with streptavidin horseradish peroxidase (HRP) solution and visualized with DAB. Finally, the sections were blocked with 100% glycerin. An in vitro in situ cell death detection kit (11684817910, Roche, BASEL, SWZ) was used to assess podocyte apoptosis following the manufacturer’s protocol. Podocytes were cultured in 6-well plates and treated with different media for 48 h. Then, they were incubated with the TUNEL reaction mixture for 1 h at 37 °C, washed with PBS, and counterstained with DAPI. The apoptotic cells in the kidney sections were observed with a Leica microscope (Aperio CS2, Germany), and the apoptotic podocytes were observed under a fluorescence microscope (CKX41, OLYMPUS). Image-Pro Plus 6.0 software was used to analyse and quantify the data.
Mitochondrial Respiratory Chain Complex Measurement Kidney tissues were minced, and the activities of mitochondrial respiratory chain complexes I, III, and IV were measured using mitochondrial respiratory chain complex I, III, and IV activity detection kits (BC0515/BC3245/BC0945, Solarbio, Beijing, China) according to the manufacturer’s instructions. Podocytes were cultured in 6-well plates and treated with different media for 48 h. After digestion with trypsin, the podocytes were collected and used for analysis following the instructions.
Flow Cytometry Podocytes were cultured in 6-well plates and treated with different media for 48 h. The level of podocyte apoptosis was measured via an Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit (556547, Becton Dickinson and Company, NY, USA). Briefly, the density of podocytes was adjusted to 1×106 cells/mL, and then, 5 μl Annexin V-FITC and 5 μl propidium iodide (PI) were added to 100 μl cell suspensions. After incubation at room temperature for 30 min in the dark, podocytes were centrifuged and resuspended in binding buffer. The mitochondrial membrane potential (MMP) level was measured via a JC-1 assay kit (C2006, Beyotime Biotechnology, Shanghai, China). Briefly, 100 μl of cell suspensions were collected and incubated with JC-1 working solution at 37 °C in the dark for 20 min. Then, the podocytes were washed with JC-1 staining buffer (1X) and resuspended in binding buffer. The generation of ROS by podocytes was measured using the 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) activity assay kit (red) (MAK145, Sigma), which includes an intracellular ROS fluorescent probe. Briefly, the cell suspension was collected and centrifuged, and then podocytes were resuspended in ROS working solution and incubated at room temperature in the dark for 20 min. A flow cytometer (Calibur II, Becton, Dickinson and Company, USA) was used to analyse the podocytes from the different groups, and FlowJo software was used to analyse the levels of Annexin V-FITC/PI, MMP and ROS.
AMPKα-targeting small interfering RNA (AMPKα siRNA) Transfection AMPKα siRNA (45313, Santa Cruz Biotechnology) was transfected into cells with the Lipofectamine® RNAiMAX transfection kit (13778150, Invitrogen) according to the manufacturer's protocol. Briefly, podocytes were cultured in 6-well plates for 24 h. RNAiMAX transfection reagent and AMPKα siRNA were added to the reaction mixture. Then, the podocytes were cultured with serum-free medium and reaction mixture for 24 h, and the medium was changed for 6-8 h. After the transfection was completed, the podocytes were treated for 48 h with various mediums. The protein level of AMPKα was measured by western blotting analysis to confirm transfection success. Podocytes were collected 24 h after transfection for the following experiments.
Western Blotting (WB) Analysis The renal cortex tissues and podocytes were lysed with radio immunoprecipitation assay lysis buffer (1:50, C1053, Applygen, Beijing, China) supplemented with protease inhibitors and protein phosphorylase inhibitors (1:100, P1260, Applygen). The renal cortex tissues were cut into pieces, and podocytes were harvested by scraping with a cell scraper; then, the samples were lysed via intermittent ultrasound for 3 min. After centrifugation at 15000 rpm at 4 °C for 15 min, the supernatants were harvested to measure the protein concentration at 562 nm with the bicinchoninic acid (BCA) protein quantification kit (P1511, Applygen). The protein extraction solution was diluted with loading buffer (5X), and the samples were incubated at 95 °C for 15 min, aliquoted, and stored at -80 °C. WB analysis was performed using a standard protocol. Briefly, markers and samples were added to the designated wells of electrophoresis gels. The proteins were transferred to membranes after electrophoresis and then blocked. The anti-nephrin (1:1000, ab216341, Abcam), anti-podocin (1:1500, ab50339, Abcam), anti-cleaved caspase-3 (1:1000, 19677-1-AP, Proteintech), anti-peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α, 1:500, AF5395, Affinity), anti-transcription factor A (TFAM, 1:2000, ab131607, Abcam), anti-dynamin-related protein 1 (DRP1, 1:1000, ab184247, Abcam), anti-mitochondrial fusion protein 2 (MFN2, 1:1000, 9482S, CST), anti-AMPKα (1:1000, 5831T, CST), anti-p-AMPKα (1:1000, 2535S, CST) and glyceraldehyde phosphate dehydrogenase (GAPDH, 1:5000, 10494-1-AP, Proteintech) primary antibodies were added to the membranes and incubated at 4 °C overnight. After washing, the membranes were incubated with goat anti-rabbit IgG (1:5000, C1309, Applygen) secondary antibody at room temperature for 1 h, and excess secondary antibodies were removed with western washing buffer. The bands were visualized by enhanced chemiluminescence (ECL) hypersensitive luminescence solution in a dark room, and the densitometry values were measured with ImageJ.
Quantification of Mitochondrial DNA The relative copy number of mtDNA was determined based on the ratio of mtDNA to nuclear DNA (nDNA) and measured by qPCR assay. Cytochrome b (Cyt B) and cytochrome c oxidase subunit II (COII) were used as controls for mtDNA, and GAPDH was used as a control for nDNA. The primer sequences (synthesized by Bao Biological Engineering Co., LTD, Dalian, China) are listed in Table 1. Total DNA was extracted from renal tissues and podocytes with a universal genomic DNA purification mini spin kit (D0063, Beyotime Biotechnology) according to the manufacturer's instructions. A Talent quantitative real-time PCR (qPCR) kit (RR003Q, Bao Biological Engineering Co., Ltd., Dalian, China) was used to perform the qPCRs (5 min denaturation step at 95 °C, then 40 cycles of 10 s at 95 °C, 30 s at 60 °C and 30 s at 70 °C) using a Fast Real-Time PCR system (Roche, Switzerland). The 2-ΔΔCt method was used to calculate the relative expression.
Table 1 Primer information
Gene symbol
|
Primers
|
Sequence (5′→3′)
|
Gene ID
|
Product Length (bps)
|
COII
|
Forward
|
ACCTGGTGAACTACGACTGCTAGA
|
NC_005089.1
|
184 bp
|
|
Reverse
|
CCCTGGTCGGTTTGATGTTACTGT
|
|
|
Cyt B
|
Forward
|
TTCGCAGTCATAGCCACAGCATT
|
NC_005089.1
|
242 bp
|
|
Reverse
|
TGGAGGAAGAGGAGGTGAACGATT
|
|
|
GAPDH
|
Forward
|
GAAGGTGGTGAAGCAGGCATCT
|
NC_000072.7
|
116 bp
|
|
Reverse
|
CGGCATCGAAGGTGGAAGAGTG
|
|
|
Statistical Analysis Normally distributed data were presented as mean ± standard deviation. One-way analysis of variance (ANOVA) was used for multiple group comparisons, and the least significant difference (LSD) test was used for pairwise comparisons. While skewed distribution data were presented as the median and interquartile range (IQR) and compared using the nonparametric test. Wilcoxon Rank Sum test was used to compare the differences between the two groups. The data came from at least three separate tests. P < 0.05 was considered statistically significant. Statistical and data analyses were performed with International Business Machines Corporation Statistical Product and Service solutions (IBM SPSS) 26.0 software. The graphical results were analysed using GraphPad Prism 7.0, and composite figures were generated with Adobe Illustrator CC 2018.