Patients And Tissue Sample Collection
Seven tissue samples were collected from patients with vulgaris psoriasis(4 men and 3 women, ages 18–49 years) from Qilu Hospital of Shandong University. These patients did not receive systemic or topical treatment within 3 months of sample collection. Seven normal tissue samples were collected from healthy volunteers with no family history of psoriasis or any other autoimmune disease. The study was approved by the ethics Committee of Shandong University, Qilu Hospital (Jinan, China), and written informed consent was obtained from all participating patients. All specimens were confirmed via pathological examination.
Lncrna Microarray
Affymetrix GeneChip Human Gene 2.0 ST Array (Invitrogen) was used for lncRNA expression profiling. Cells were cryopulverized and homogenized using BiopulverizerTM (Biospec) and Mini-Bead-Beater16 (Biospec), respectively. Homogenized samples were then separated. RNA was precipitated, washed with 75% ethanol, and dissolved in RNase-free water. Quick Amp Labelling Kit (Agilent 5190 − 0442)was used to label the reaction. Labeled/amplified RNA was purified,and labeled cRNA quality was measured. Hybridization was performed using Agilent Gene Expression Hybridization Kit (Agilent 5188–5242). Results were analyzed using an Agilent microarray scanner (Agilent G2565BA).
Cell Isolation And Culture
Skin specimens from young boys’ foreskins were obtained from Qilu Hospital. The epidermis was dissected from the dermis after digestion of specimens with dispase II (Sigma, lot #BCBR9297 V) overnight at 4°C. Epidermal specimens were then digested with a 0.25% trypsin-0.01% EDTA mixture (37°C, 10–15 min) to obtain single cell suspensions. Cells were grown and maintained in keratinocyte medium (ScienCell, CA, USA). The third passage of NHEKs was used for subsequent experiments. The Ker-CT human hTert keratinocyte cell line (American Type Culture Collection ATCC® CRL-4048™) was cultured in KGMGold™ with BulletKit™ medium (Lonza #00,192,060). All cells were incubated in a humidified chamber at 37°C with 5% CO2.
Rna Fluorescence In Situ Hybridization (Fish)
Cy3-labeled probes were designed and synthesized by RiboBio (RiboBio Biotechnology) to perform RNA FISH using RiboBio FISH Kit (RiboBio Biotechnology). Briefly, paraffin embedded tissue sections and cell samples were fixed with 4% paraformaldehyde, digested with proteinase K, blocked with a pre-hybridization solution and hybridized overnight with a Cy3-labeled GDA probe at 4°C. Images were acquired using an A1RþMP confocal laser microscope (Nikon).
Rna Extraction And Quantitative Reverse Transcription-polymerase Chain Reaction (Qrt-pcr)
Total RNA was extracted from tissues and cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed to cDNA using a Transcriptase Kit (Takara, Otsu, Japan). Next, qRT-PCR was performed using TB Green PCR Master Mix (Takara) with CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad). The sequences of the primers are summarized in Table 1.
Table 1
Sequences of primers for qRT–PCR.
Primers | Forward sequence (5’-3’) | Reverse sequence (5’-3’) |
Human GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
Human lnc-GDA-1 | GAGATGCCATCCTCCACTTCC | TTACAGGCGTGAGCCACTACC |
Human FOXM1 | GGAGGAAATGCCACACTTAGCG | TAGGACTTCTTGGGTCTTGGGGTG |
Construction Of Psoriatic Cell Mode
When cells were 60–70% confluent, they were starved in serum-free DMEM for 12 hours. NHEKs and Ker-CT were then treated with M5 (cytokine cocktail consisting of IL-17A, TNF-α, IL-1α, IL-22, and oncostatin-M, 10 ng/ml final concentration; Peprotech) in serum-free DMEM to induce psoriatic inflammation-like conditions for an additional 24 hour. Controls were left untreated.
Cell Transfection
For gene silencing, small interfering RNA (siRNA) (GenePharma, Shanghai, China) of lnc-GDA-1 was transfected into NHEKs and Ker-CT cells using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA). Oligonucleotide sequences are listed in Table 2. For gene overexpression studies, NHEKs and Ker-CT cells were transfected with eukaryotic expression vector pcDNA3.1 using Jet PRIME transfection reagent (Polyplus, USA). An empty vector (OE-NC) was used as a control. Cells were collected for further treatment or analysis at different time points after transfection. Transfection was performed according to the manufacturers’ instructions.
Table 2
Oligonucleotide sequences.
siRNA | Sense (5’→3’) | Antisense (5’→3’) |
siGDA | CAAAAAAUACAAAAUAAUATT | UAUUAUUUUGUAUUUUUUGTT |
siNC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Western Blot
Total cellular protein was prepared using RIPA lysis buffer (Beyotime, Beijing, China), and protein concentrations were measured using a BCA protein assay kit (Beyotime), following the manufacturer’s protocols. Equal amounts of protein were loaded for SDS-PAGE and then transferred electrophoretically to a PVDF membrane (Millipore, USA). After blocking with TBST (5% milk), membranes were incubated overnight with primary antibody (1:1000) at 4°C. After washing and incubation, membranes were incubated with secondary antibody (1:2000) in TBST. Protein expression levels were detected with ECL Plus (Millipore, Billerica, MA, USA) using the Bio-Imaging System. The following primary antibodies were used: GAPDH (Cell Signaling Technology, Cat#5174); p-STAT3 (Cell Signaling Technology, Cat#9145); STAT3 (Cell Signaling Technology, Cat#9139); p-NF-κB (p-p65; Cell Signaling Technology, Cat#3033); NF-κB (p65; Cell Signaling Technology, Cat#8242); cyclin D1 (Cell Signaling Technology, Cat#2978); and FOXM1 (Abcam, Cat#207298).
Cell Counting Kit-8 (Cck8) Assay
Cells were counted using Cell Counting Kit-8 (CCK8) (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) 24, 48, and 72 hours after transfection. CCK-8 solution was added, and cells were incubated for 1 hour at 37 ℃ in the dark. The optical density (OD) value was measured at a wavelength of 450 nm using a microplate reader (BioTek, USA).
Flow Cytometry Analysis
Cell cycle was studied using a DNA staining cell cycle Kit (Solarbio). Cells were harvested and fixed in cold 70% ethanol at 4°C for 2 hours, and RNase A solution was added to suspend cells for 30 min at 37°C. After incubation with PI staining solution at 4°C for 30 min in the dark, cell suspension was analyzed by FACS Calibur (BD Biosciences).
Enzyme-linked Immunosorbent Assay (Elisa)
After 24 hours of transfection, cells were stimulated with M5, and supernatants collected after 24 hours. Levels of IL-1β, IL-6, and chemokine ligands 2 and 20 (CCL2 and CCL20) were measured by ELISA (Keyybio, China). Absorbance at a wavelength of 450 nm was measured using a microplate reader (BioTek, USA).
Statistical analysis
All statistical analyses were performed using GraphPad Prism 9 software (GraphPad Software). Data from at least three independent experiments were presented as mean ± standard deviation (SD). Comparisons were performed using Student’s t-test and analysis of variance. P < 0.05 was considered statistically significant.