Chemicals and Reagents
PK-15 cells were purchased from the Cell Culture Centre, Institute of Basic Medical Science, Chinese Academy of Medical Sciences (Beijing, China). KN93, Enhanced Cell Counting Kit-8 (CCK-8), Reactive Oxygen Species (ROS) Assay Kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). anti-p-CaMKII antibody was purchased from Cell Signaling Technologies (Beverly, MA, USA). anti-CaMKII antibody and anti-GAPDH antibody were obtained from Proteintech (Wuhan, China). The anti-rabbit and anti-mouse secondary antibodies were purchased from Boster (Wuhan, China). Annexin V-FITC Apoptosis Detection Kit was purchased from BD Biosciences (San Diego, CA, USA).
Animals
All animal experiments were performed according to the Care and Use of Laboratory Animals of the Animal Ethics Committee of Sichuan Agricultural University (Ya’an, China) (Approval No.SYXK 2019 − 187). Eight weeks of C57BL/6 male mice(18-22g) were obtained from Chengdu Dossy Experimental Animal Co., Ltd (Chengdu, China). All mice were housed in an appropriate temperature animal facility and had unlimited access to water and food.
Expression and purification of recombinant Sly
Recombinant Suilysin (rSly) was expressed in E.coli BL21 (DE3) (Biomed, Beijing, China). E.coli BL21 (DE3) (pCold I-sly) was grown in LB medium until achieving the OD600nm of 0.6–0.8, and isopropyl thio-D-galactopyranoside (IPTG) (Solarbio, Beijing, China) was used to induce the expression of rSly at 18℃, 180 r/min for 24 h. After the bacteria were collected by centrifugation at 4℃ and lysed by sonication, the supernatant was obtained by centrifugation. Ni2+ column (Bio-Rad, Hercules, CA, USA) was used to purify His-tagged rSly, and rSly was eluted with 240 mM imidazole. Purified proteins were controlled by separation in SDS-polyacrylamide gels and immunoblot analysis using anti-Sly antibody (self-made by the research group).
Recombinant Suilysin D4 was expressed and preserved by our laboratory (Sichuan Agricultural University, Chengdu, China).
Cell culture and stimulation
The PK-15 cell line was incubated in DMEM (Gibco, Beijing, China) containing 10% fetal bovine serum (Gibco, Beijing, China), 100 U/mL penicillin, and 100 mg/mL streptomycin (Solarbio, Beijing, China) at 37°C with 5% CO2. PK-15 cells were pretreated with different doses of KN93 (1, 5, 10, 15, and 20 µM) for 24 h to select the minimum safe concentration, and then different concentrations of rSly (0.3 µg/mL, 0.6 µg/mL) were incubated for 24 h. Finally, the cells were collected for subsequent experiments. In the control group, PK-15 cells were only incubated with 0.1% DMSO (Solarbio, Beijing, China).
Quantitative real-time PCR assay
The expression levels of genes(CAMK2A, CAMK2B, CAMK2D, CAMK2G) were evaluated by reverse transcription qPCR. The primer sequences are listed in Table 1. Total RNA in PK-15 was extracted with the Axygen Total RNA Miniprep Kit (Jiangsu, China) according to the manufacturer’s instructions. The RNA concentration was determined. cDNA was synthesized with a reverse transcription kit (Yeasen, Shanghai, China) and amplified with a PCR instrument. qPCR was conducted using an SYBR Green PCR kit (Yeasen, Shanghai, China) on a Roche Real-Time PCR System (Basel, Switzerland). The reaction conditions were as follows: preheating at 94°C for 10 min, denaturation at 94°C for 20 s, annealing at 55°C for 20 s, and extension at 72°C for 20 s for 40 cycles. GAPDH was used as a control for normalization of qPCR results.
Table 1
Primer name | Primer sequence(5’-3’) | Product length(bp) |
CAMK2A-F | GACGAAGACACCAAAGTGCG | 198 |
CAMK2A-R | CCGGGACCACAGGTTTTCAA |
CAMK2B-F | CCCTGGGCAATCTGGTTGAA | 101 |
CAMK2B-R | CGGGTTCAGGATGGTTGTGT |
CAMK2D-F | GGGATGAAGACCAACACCGA | 153 |
CAMK2D-R | CCTCTGAGGCTGTGATACGC |
CAMK2G-F | ATCAACAATGGGGACTTTGAGG | 100 |
CAMK2G-R | AATCCATCCCTTCCACCAGGTT |
GAPDH-F | ACATGGCCTCCAAGGAGTAAGA | 106 |
GAPDH-R | GATCGAGTTGGGGCTGTGACT |
Western blot analysis
Cells were lysed in RIPA buffer (Solarbio, Beijing, China) containing protease (Solarbio, Beijing, China) and phosphatase inhibitors (Beyotime, Nanjing, China). Equal amounts of protein extract were loaded and separated by SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA) were blocked for 2 h at room temperature with 5% non-fat milk (Sangon Biotech, Shanghai, China) in TBST, and then incubated with primary antibodies anti-CaMKII (1:5000, 45–60 kDa), anti-phospho-CaMKII Thr286 (1:1000, 50, 60 kDa) and anti-GAPDH (1:5000, 37kDa) overnight at 4℃, followed by HRP-labeled secondary antibodies. Labeled proteins were visualized with an enhanced chemiluminescence system. For quantification optical densities of proteins were determined by Gel-Pro analyzer software (Media Cybernetics, Rockville, MD, USA).
Cell cytotoxicity and viability analysis.
About 1 × 104 cells/well were seeded in 96-well flat bottom plates and incubated at 37℃, 5% CO2 for 24 h to obtain 80%-90% confluence. rSly was added to all the test sample cells except the control group and incubated for 24 h. The CCK-8 stock solution was diluted 1:10 in unsupplemented DMEM to make the CCK-8 working solution. 100 µL of the CCK-8 working solution was added to each well, and the plate was incubated for 1 h at 37℃. Absorbance at 450 nm was measured using a multifunctional chemical immunometer (Thermo Fisher Scientific, MA, USA) .
Generation of PK-15 KO cell lines by CRISPR/Cas9 technology
The sgRNA sequence targeting the porcine CAMK2A, CAMK2B, CAMK2D, CAMK2G were cloned into the linearized lentiCRISPRv2, respectively, and then lentivirus was assembled to infect PK-15 cells. 10 µg/mL puromycin (Solarbio, Beijing, China) was used to select positive KO cells. Approximately 7 days after screening, the cells colonies were analyzed by extracting genomic DNA, and the nucleotide sequences were revealed by Sanger sequencing.
Immunofluorescence staining
PK-15 cells were cultured on coverslips in 12 well plates for 24 h to obtain 50%-60% conflence, KN93 was treated or untreated for 24 h, rSly was diluted to 1 µg/mL with cold PBS, and rSly was allowed to bind to the membrane for 2 h at 4℃. Cells were fixed in 4% paraformaldehyde for 10 min. After washing with PBS, blocked with 2% BSA in PBS for 1 h. Then cells were incubated with Sly antibody overnight at 4℃. Then cells were incubated with secondary antibodies. After washing, the cells were incubated with DAPI to stain the nucleus. Images were acquired using a confocal microscope (Olympus, Tokyo, Japan).
ROS assay
Approximately 2 × 105 PK-15 cells/well were seeded in 6-well plates for 24 h to obtain 50%-60% confluence. The wells were treated or untreated with 10 µM KN93 at 37℃ for 24 h, then incubated with rSly for 24 h. Intracellular ROS was measured by the DCFH-DA fluorescent dye. Cells were incubated with 10 µM DCFH-DA diluted in serum-free culture media for 30 min in the dark. And cells were collected after washing with PBS, then the fluorescence was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm.
AO/EB staining
Acridine orange (AO) and ethidium bromide (EB) are fluorescent intercalating DNA dyes that allow for differentiation of live, apoptotic, and necrotic cells. AO can penetrate cells with intact membrane, and EB can only penetrate cells with damaged membrane, causing cells to emit green or red fluorescence respectively (Braun et al. 2016). PK-15 cells were plated at a density of 2 × 105 cells per well in 6-well plates and then incubated. After exposure to NAC or KN93 for 24 h, then cells were treated with 0.6 µg/mL rSly for 24 h. Floating cells were collected with 100 µL PBS, AO and EB were mixed at a ratio of 1:1 to make a working solution. 2 µL working solution was used to dye cells, then the dyeing cells were dropped on a slide and covered with a coverslip. The images were photographed by fluorescence microscope, and counting 20–200 cells to analyze.
Apoptosis analysis
To measure apoptosis of cells, Annexin V and PI double staining was performed by using an Annexin V/PI apoptosis detection kit according to the supplier’s manual. Cells were detached with 0.05% trypsin and counted 1 × 105 cells. Cells were then centrifuged in the binding buffer supplied by the kit, and immunostained with Annexin V-FITF (5 µL) and PI (5 µL) for 15 min at room temperature in dark. Cells were measured by flow cytometry (BD Biosciences, San Diego, CA, USA), and the percentage of apoptosis was analyzed by Flowjo software (Flowjo LLC, Ashland, OR, USA).
KN93 anti-suilysin in vivo experiment
To assess the effect of KN93 on Suilysin-induced injury, C57BL/6 mice were used for in vivo experiments. Mice were stratified into three groups, namely, control (PBS), dimethy1 sulfoxide (DMSO), KN93. There were ten mice in each group. Each group was inoculated with PBS, DMSO, KN93 respectively. Daily injection of KN93 (10 µmol/kg, i.p.) or an equivalent volume of DMSO or PBS for 7 d ( Zhang et al. 2016). Mice were monitored body weight at the same time daily. 24 h later, the minimum lethal dose of rSly (2.5 µg/g) was injected into mice i.p..
Statistical analysis
Statistical analysis was performed by the Graphpad Prism 8 software (GraphPad, San Diego, CA, USA). The means ± S.D. were determined for each treatment group. Two-tailed Student’s t-test was used to determine significant differences between the treatment and control groups (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, ns, no significant).