68 children aged 4–14 years old who underwent adenotonsillectomy(ATE) for OSAS or primary snoring (PS) were recruited in our hospital from January 2019 to June 2021. The primary inclusion criteria were: (a)Snoring lasted for more than 6 months, and the conservative treatment was ineffective; (b) PSG was performed before operation; (c)No previous history of tonsil and / or adenoidectomy. Exclusion criteria were: (a)acute inflammation; (b) respiratory tract infection or asthma; (c)immunodeficiency; (d) pulmonary or cardiac disease and obesity. The sample size reached the statistical requirement criteria by statistical calculation.
The diagnosis of OSAS was defined as obstructive apnea hypopnea index(OAHI) > 1 according to Chinese guideline for the diagnosis and treatment of childhood obstructive sleep apnea[12]. Primary snoring was considered in the presence of habitual snoring with OAHI ≤ 1 confirmed by polysomnography(PSG). Tonsil size was graded from 0 to 4 according to Michael Friedman’ report[13]. Tonsil size I implies tonsils hidden within the pillars. Tonsil size II implies the tonsil extending to the pillars. Size III tonsils are beyond the pillars but not to the midline.Size IV implies tonsils that extend to the midline. Adenoid size was graded from 0 to 4 according to A/N of X-ray[14] or fiberendoscopic findings[15]. A/N :Grade I 0.5–0.6, Grade II 0.61–0.70, Grade III 0.71–0.8,Grade IV > 0.80. Adenoid tissue rhinopharyngeal obstruction grading based on fiberendoscopic findings: Grade I 0–25%,II 26%-50%,III 51%-75%, Ⅳ 76%-100%.The research was approved by ethical standards of Ethics Committee of our hospital. Study purposes were consented by the participants and their guardians. The children involved in the study were adequately protected and the information disclosing was only upon reasonable request. We confirmed that all experiments were performed in accordance with relevant guidelines and regulations.
Reagents And Tonsil Tissue Preparation
RNA simple Total RNA Kits were purchased from ZhongKe XinChuang(TIANGEN DP419,Beijing ,China).The AMV First Strand cDNA Synthesis Kit)(B532445 ), 2xSG Fast qPCR Master Mix(Low Rox, SYBR, B639272) were purchased from Sangon Biotech(Shanghai,China). ELISA kits of YKL40, IL-6, IL-8, and IL-10 were purchased from Invitrogen and ELISA kits of TNF-α were purchased from Immunoway (Beijing,China) .Recombinant Human YKL40 was purchased from R&D systems (2599-CH-050, Minneapolis, MN,USA). Phospho-NF-kB p65-S536 Rabbit pAb (polyclonal antibody)(P-P65), NF-kB p65 Rabbit mAb (monoclonal antibody) ( P65)and β-actin Rabbit mAb (β-actin )were purchased from ABclonal (Wuhan, China). Antibody of YKL40 was purchased from Abcam(Cambridge, MA, USA).NF-κb activator (N-3-oxo-dodecanoyl-L-Homoserine,3-oxo-C12-HSL, 3-oxo) and NF-κb inhibitor (Bay 11-7082, Bay) was purchased from APExBIO (Houston,TX ,USA). Fetal Bovine serum (FBS)and Roswell Park Memorial Institute (RPMI) 1640 medium were purchased from Gibco(Invitrogen,CA,USA). RIPA Lysis Buffer was purchased from Ecotop Scientific (Guangzhou,China) .100× Protease Inhibitor Cocktail was purchased from Sangon Biotech(Shanghai,China). All primers (Table 1)were designed and synthesized by Sangon Biotech( Shanghai,China).
Table 1
Sequences of PCR primers and size of amplicons
Primer | Sequence | Size(bp) |
YKL40 | FORWARD CTTTCCTGGTCGTCGTATCCTA | 81 |
| REVERSE CACAGTCCATAGAATCCTCGG | |
IL-6 | FORWARD GGTGTTGCCTGCTGCCTTCC | 95 |
| REVERSE GTTCTGAAGAGGTGAGTGGCTGTC | |
Il-8 | FORWARD AACTGAGAGTGATTGAGAGTGG | 147 |
| REVERSE ATGAATTCTCAGCCCTCTTCAA | |
IL-10 | FORWARD GCCAAGCCTTGTCTGAGATGATCC | 82 |
| REVERSE GCCTTGATGTCTGGGTCTTGGTTC | |
TNF-α | FORWARD TGGCGTGGAGCTGAGAGATAACC | 134 |
| REVERSE CGATGCGGCTGATGGTGTGG | |
β-actin | FORWARD GGCCAACCGCGAGAAGATGAC | 138 |
| REVERSE GGATAGCACAGCCTGGATAGCAAC | |
Tonsil tissues of the enrolled children were removed by otorhinolaryngologic surgeons according to the standard operation. Tissues that were not required for pathologic diagnosis were collected and the capsules were separated.Tonsil tissues were divided into three parts separately for protein and RNA extraction and for cell culture.Two parts of approximate100mg tissues for protein and RNA extraction were cleaned by aicy phosphate-buffered saline (PBS) and immediately delivered to laboratory with two labeled sterile enzyme-free frozen storage tubes in liquid nitrogen. Another portion of tonsil lymphoid tissue was cut into small pieces and washed with icy phosphate-buffered saline (PBS) plus 100×Penicillin-Streptomycin solution and immediately delivered in the solution to the laboratory within 10 minutes for cell culture.
1.1 ELISA in protein samples of tonsil tissues.
100mg prepared tonsil lymphatic tissue was triturated in liquid nitrogen and added 1ml RIPA lysis buffer with PMSF and 100× Protease Inhibitor Cocktail(100:1). The homogenized tissue mixture was placed on ice for 30 minutes and then in centrifuge at 4℃,12000rpm for 15min. Protein of tonsil tissues was in the supernatant. Protein concentration was determined using a bicinchoninic acid (BCA) protein assay (Biosharp, China). The supernatant of tonsil tissue protein was collected and the concentrations of inflammatory mediators were determined by ELISA kits according to the manufacturer’s protocol. The sensitivity of YKL40, IL-6, IL-8, IL-10, and TNF-α were 10.83 pg/ml,0.92 pg/ml, ≤ 5 pg/ml,1.0% pg/ml,and 2.3 pg/ml respectively. Optical density at 450 nm was determined using an Auto-Reader Model (SpectraMax i3x, MD, CA).
1.2 Real-time Pcr Of Tonsil Tissues
100 mg prepared tonsil lymphatic tissues with 1ml lysate RZ were homogenized with a homogenizer and the samples were placed at 15–30℃ for 5 min for complete separation of the nucleic acid protein complex. Then total RNA was extracted according to RNA simple Total RNA Kit. Total RNA was diluted 5 times by ddH2O and the concentration was measured for three times. The RNA concentration was the average value of 3 times measured concentration, and the total RNA concentration was adjusted at 1µg /µl. 1µl (1µg) total RNA was used for synthesizing the cDNA using the AMV First Strand cDNA Synthesis Kit. The reaction was 42℃ 45min, 85℃ 5min, 4℃. The cDNA products were diluted to 60 ul with ddH2O .1ul (16.7ug)cDNA (concentration of cDNA < 20ng 20µl rxn.༉was used for the real-time PCR reaction using 2xSG Fast qPCR Master Mix. The PCR reaction parameters were 95℃ 3min, followed by 40 cycles at 95℃ 3S,60℃ 30S,then 95℃ 15S, 60℃ 30S, 95℃ 1s on a Thermo ScientificTM, ABI QuantStudio 5 (ABI Applied Biosystems). β-actin was used as an internal control. The mRNA expression of genes was normalized to β-actin and expressed as relative fold of change using the formula of 2 −△△ Ct.
2 Primary Tonsil Lymphocyte Culture
Lymphoid tissues for cell culture were immediately delivered to the laboratory within 10 minutes. The dissected tissue pieces were placed into a 6cm petri dish with sterile, icy PBS plus 100× Penicillin-Streptomycin solution, and then dissociated by grinding the tissue through the sieve with a syringe plunge and transferred the contents into a 70um cell strainer. The suspension was pelleted (1,500 rpm for 5 minutes) and then the supernatant was abandoned. Memorial Institute (RPMI) 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100× Penicillin-Streptomycin were added to suspend tonsil lymphocytes. The tonsil lymphocyte suspension was transferred into four 6-round well plates and 4/6 wells of each plate were divided into Control, 10ng/ml-YKL40,100ng/ml- YKL40,1000ng- YKL40 groups. In a 5% CO2 incubator at 37°C for 6H ,12H ,24H,48H, the supernatant and cells were respectively collected after centrifugation in different groups.
2.1 Reagent Experiments
To investigate the effect of rhYKL40 on PTLCs, PTLCs were incubated with a range of rhYKL40 concentrations for various periods of time. After centrifugation, PTLCs of different treatment groups were respectively collected. Total RNA of PTLCs was isolated using RNA simple Total RNA Kit. Then the RNA concentration was qualified using nanodrop. The optical density (OD) 260/280 = 1.9-2.0 indicates that RNA purity was high. The total RNA concentration was adjusted at 500ug/ul. 1µl (500µg) total RNA was used for synthesizing the cDNA using the AMV First Strand cDNA Synthesis Kit. The reaction was 42℃ 45min, 85℃ 5min, 4℃. The cDNA products were diluted to 40 ul with sterilized ddH2O. 1ul (12.5ug) cDNA was used for the real-time PCR reaction using 2xSG Fast qPCR Master Mix. Primers and PCR operation were according to 1.2.
2.2 Real-time Pcr Analysis
PTLCs were collected and total RNA was extracted after 24H treatment of control, 100ng/ml- YKL40, NF-κb activator(3-oxo ),and NF-κb inhibitor (Bay 11-7082). All primers were shown in Table 1.The cDNA synthesis, PCR reaction and mRNA expression of genes were operated according to 1.2
2.3 Western Blotting
To investigate NF-κb activation of rhYKL40 in PTLCs, the cultures of PTLCs were divided into four groups:Control (YKL40 0ng/ml),YKL40 (rhYKL40 ,100ng/ml),NF-κb activator (N-3-oxo-dodecanoyl-L-Homoserine lactone100 uM,pretreated for 1 hour and then exposed to 100ng/ml rhYKL40)or NF-κb inhibitor(Bay 11-7082 ,5uM, pretreated for 1 hour and then exposed to 100ng/ml rhYKL40) for 48H.
The cells were collected and then the protein of cells was extracted in RIPA lysis buffer with PMSF and 100× Protease Inhibitor Cocktail. Cell protein concentration was measured using BCA protein assay. The protein concentration of each sample was adjusted to 2µg/µl. 5× SDS-PAGE Sample Loading Buffer was added to the protein samples and stored in -20℃.
10ul protein samples were equally loaded on 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and transferred onto 0.22um polyvinylidene fluoride (PVDF) membrane (Millipore). After blocking with 5% nonfat milk in TBST for 60 minutes, the membranes were incubated with primary antibodies against p65, p-p65 (1:1000 dilution),and β-actin (1:2000 dilution) overnight at 4˚C. This was followed by the addition of secondary antibodies conjugated with HRP(Ab clonal,1:5000 dilution) at 37 ˚C for 60 minutes. Detection was visualized using an ECL assay kit (Biosharp life sciences). The phosphorylation levels of P65 were analyzed with the NIH ImageJ program and were expressed as fold changes compared to the levels of β-actin.
3 Statistical Analysis,
Statistical analyses and data visualization were performed in GraphPad Prism (version 7). Data are reported as the mean ± standard deviation or Median ± IQR (Inter quartile range). T test was used to determine the statistical significance of two groups.Shapiro–Wilk normality test was used to test the normality. If samples can not satisfy the normality test, Mann-Whitney U Test was used to analyze significant differences between groups.Chi-square was used to evaluate rates between two groups. Tukey’s honestly significant difference test was used to analyze significant differences between pairs of groups. Spearman coefficient was used to analyze the correlation between the relative expression of YKL40 and IL-6,IL-8,IL-10, and TNF-α. P value < 0.05 was considered statistically significant.