Animal experiment
The Changsha Tianqin Biotechnology Co. ltd. (Changsha, China) provided 24 specific pathogen-free male Sprague-Dawley (SD) rats, (age, 6–8 weeks and weight, 200–250 g). The animal model was established as described above, ventilation parameters were set as follows: TV, 40 ml/kg; respiratory rate, 60 breaths/min; positive endexpiratory pressure, 0 cmH2O.
Six rats per group were randomly assigned to four groups: Control (spontaneous breathing), high tidal volume group (HV), high tidal volume + normal saline group (NS), high tidal volume + apelin-13 group (apelin-13). In the group Control, spontaneous respiration was retained after tracheotomy and intubation without mechanical ventilation. The rats in other groups were cut open and connected with small animal ventilator. 30 minutes before the experiment, the endogenous apelin receptor agonist [Pyr1] - Apelin-13 (MedChemExpress, USA) was injected into the apelin-13 (10 nmol/kg, intraperitoneal injection); The group HV + NS received intraperitoneal injection of the same amount of normal saline as the control; Observe mechanical ventilation or spontaneous breathing for 4 hours. Increase initial anesthesia by about 1/3 per hour. For follow-up experiments, rats were euthanized after 4 h of MV or spontaneous breathing. Their bronchoalveolar lavage fluid (BALF) and lung tissue were collected. According to the National Institutes of Health’s (National Institutes of Health) (NIH publication No. 85–23, 2011) Guidelines for the Care and Use of Experimental Animals, this experiment was conducted. Animal experimental protocols were approved by Guizhou Medical University’s Animal Experimental Ethics Checklist (approval number: 2001132) and followed AVMA guidelines for animal euthanasia and ARRIVE guidelines.
Hematoxylin-eosin (HE) staining
Following the establishment of the model, the lung tissue was fixed in formalin solution, stored at 4 ◦C for 24 h, dehydrated with gradient ethanol, and paraffin embedded. The sample was sliced into 4 um thick sections, and stained with Hematoxylin-eosin (Solarbio, China).After soaking with gradient ethanol, the section was mounted with a neutral balsam and cover glass. The alveolar morphology was considered under optical microscope and scored according to the pulmonary lesion scoring system[18].
Immunofluorescence staining
The expression levels of APJ(1:800;Proteintech, China) proteins were determined using immunofluorescence. After drying at 60 ◦C for 60 min, dewaxing and hydrating the 4-um thick paraffin sections, sealing them with goat serum at 37 ◦C for 30 min, and incubating them with a specific primary antibody overnight. Rewarming at 37 ◦C for 30 min, and incubated with a fluorescent secondary antibody (1:500, Proteintech, Beijing, China) for 1 h in a wet box. After the addition of DAPI (Solarbio, Beijing, China) in the dark the tablets were re-dyed for 10 min. Finally, the slides were sealed with an anti-fluorescence quenching agent, and images were obtained using a positive fluorescence microscope.
Lung Wet/dry (W/d) Weight Ratio Detection
After euthanization, rats were cleaned with PBS to separate the right upper lung and then the lung weighed. Wet lungs were dried at 65 ◦C for 48 h and referred to as dry lungs. We calculated the lung wet weight /dry weight ratio.
Enzyme-linked Immunosorbent Assay (Elisa)
After euthanization, BALF was collected. The BALF was subjected to centrifugation at 1500 rpm for 10 min and the supernatant collected. In order to determine the expression of interleukin-1β(IL-1β), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in BALF, we used ELISA reagents (Cusabio Biotech, Wuhan, China), as instructed by the manufacturer IL-1β(CSB-E08053h), IL-6 (Ab100712) and TNF-α (CSB-E11987r). In less than five minutes, the optical density value of each sample was determined with a spectrophotometer at 450 nm.
Western Blot Analysis
The pre-cryolysis solution containing PMSF and phosphatase inhibitor was added to the tissue, ground, and cleaved thoroughly using an ultrasonic crusher. Thereafter, 5 × loading buffer was added to the protein sample. Proteins were estranged via SDS-PAGE and moved onto a polyvinylidene fluoride (PVDF) membrane, which was stuck down with 5% skim milk at 25 ℃ for 1 h and incubated overnight with a particular primary antibody APJ (1:800;Proteintech, China) or Bax (1:10, 000༛Proteintech, China) or Bcl-2(1:3,000༛Proteintech, China)or AKT༈1:7, 000༛Proteintech, China༉、P-AKT༈1:3, 000༛Proteintech, China༉at 4 ℃. The membrane was then incubated with a secondary antibody (IgG, 1:5000 Proteintech, Chicago, USA) at 25 ℃ for 1 h. Finally, imprinting was observed using enhanced chemiluminescence (ECL, P0018AM, Shanghai, China).
Real-time Quantitative Polymerase Chain Reaction (Qrt-pcr)
Sum RNA was obtained from rat lung tissue using the TRIzol kit (Thermo Fisher, USA). By using the PrimeScriptTM RT reagent kit (RR047A, Takara, Dalian, China), complementary DNA (cDNA) was synthesized from the extracted RNA. mRNA expression levels were measured in strict compliance with TB Green® Premix Ex TaqTM II instructions from Takara (RR820A, Takara, Dalian, China). GAPDH served as the internal control for APJ. All primers (Table 1) were synthesized by Shenggong Bioengineering Co. ltd. (Shanghai, China). The relation expression of the genes was deliberated using the 2-Δ ΔCT manner.
Table 1
Primer sequence for quantitative reverse transcription ploymerase chain reaction.
Name Primer sequence(5’−3’) |
Apelin F:TGCTGCTCTGGCTCTCCTTGAC R:GTTGCCTTCTTCTAGCCCTTTCCC |
GAPDH F:ATGGAGAAGGCTGGGGCTC R:AAGTTGTCATGGATGACCTTG |
Note: F, forward; R, reverse; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. |
Mpo Activity
MPO activity in supernatant of lung tissue was determined using MPO kit (Nanjing Institute of Bioengineering, Nanjing, China). The absorbance was measured at 460 nm.
Statistical analysis
All experiments were conducted with different batches of rats at least thrice. Data are expressed as mean ± standard deviation (X ± SD). Plots and statistical analyses were performed with GraphPadPrism8.3 and ImageJ1.51. Comparing two groups was done via a T test. Comparing more than two groups was done via an ANOVA followed by a Tukey post hoc test. P < 0.05 was considered statistically significant.