Mice
We obtained six to eight weeks female BALB/c mice from the Animal Laboratory Center of Ningxia Medical University (SCXK2018-0004). The mice were raised in pathogen-free conditions, with eight groups of mice in each cage and fed clean food and water. All mouse experiments were given permission by the Ningxia Medical University Institutional Review Committee and carried out in strict accordance with national and institutional guidelines.
rEg.P29 antigen preparation and vaccination protocols
The recombinant plasmid is preserved in our laboratory. Then we converted recombined plasmid P29/pET28a into E.coli BL21 pLysS and mixed them with LB liquid medium for incubation, which induced expression at 37 ℃、200 r/min for 5 h, under the condition of 1 mol/mL isopropyl-β-d-sulfur semi-lactose glycoside (IPTG, Invitrogen). Subsequently, his6-tagged rEgP29 was purified by nickel chelation affinity (Novagen) following the manufacturer’s protocol. Western blot was performed to detected the rEg.P29 purity. Next, we randomly classified twenty-four mice into two groups of twelve mice as immune and control groups. The immune group was injected subcutaneously with 10 μg purified rEg.P29 protein at three points in the abdomen. The rEg.P29 protein is emulsified with phosphate buffer saltwater (PBS) and Freund’s adjuvant in a volume of 100 μL for two times. Primary immunity used Freund’s complete adjuvant, and 2 weeks after the initial immunity, Freund’s incomplete adjuvant was used to strengthen immunity. The control group was injected with an equal volume of PBS. 2 weeks after the booster immunization, mice were used to do later experiments.
Western blot analysis
The BCA Protein Assay Kit (Beyotime Biotechnology) was used to measure the concentration of rEg.P29. Then, the rEg.P29 protein was boiled at 100 ℃, 10 min, and 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to isolate the protein. PVDF membrane (Solarbio Science Technology, Beijing, CN) was used to transfer the rEg.P29 protein. 5% skim milk was used to enclose the PVDF membrane for 2 h under room temperature, immune mice and control mice serum (1:500 dilution) were used to incubate the membrane overnight at 4 ℃. Next, the second antibody Goat Anti-Mouse IgG/HRP (Solarbio) was used to incubate the membrane for 1 h under room temperature. At last, 3,3 N-Diaminobenzidine Tertrahydrochloride Horseradish Peroxidase Color Development Kit (Solarbio) was used to detected the rEg.P29 protein.
CD4+T, CD8+T, and B cells sorting
Following booster immunization, mice were treated by cervical dislocation. All spleen and lymphocyte operations were carried out under sterile conditions. Spleens were removed from the two groups respectively. Subsequently, the single-cell suspension was prepared and then spleen tissue lymphocyte isolation medium kit (Tianjin Hao Yang Biological Manufacture, Tianjin, China) was used to isolate spleen lymphocyte cell following the manufacturer’s protocol. Finally, we diluted the cell concentration to 1´107 / mL using a 10% FBS (Gibco, Grand Island, USA) PBS solution and divided into three groups, 300 μL / tube. Furthermore, stained for cell-surface markers, including APC-labeled Anti-CD4 (552051), Percp-cy5.5-labeled Anti- CD3e(562286), PE-labeled Anti-CD8 (558106) FITC-labeled Anti-CD19 (1575-02S) (BD Biosciences, San Jose, CA, USA), placed at 4 ℃ in the dark for 30 min. After washing twice, cells were suspended using 2 mL PBS with 10% FBS and sorted by flow cytometry. Finally, collecting CD4+T, CD8+T, and B cells used to do later experiment.
lncRNA028466 overexpression lentivirus construction and siRNA synthesis
The endotoxin-free plasmid of lncRNA028466 was extracted using an endotoxin-free plasmid extract kit (Beijing Tiangen Biochemical Technology company, Beijing, China) according to the manufacture’s instruction. 293T packing cells (Thermo Fisher Scientific, CN.) were cultured with 8 mL DMEM medium (Invitrogen) with 10 % FBS (Gibco), 1% 100 х penicillin-streptomycin solution (Invitrogen) in the condition of 37 ℃ and 5% CO2 before transfection. When the cell density reached 80 % - 90 %, 293T cells were transfected with 9 µg pCDH-028466, 9 µg pLP1, 9 µg pLP2 and 9 µg pLP VSV-G (Invitrogen) in the presence of Polyjet (Signa Gen, USA) to package the recombinant lentivirus. After 48 h, the supernatant that contained virus was collected under 50,000 g 4 ℃ and virion was collected after 2 h.
Three small interfering RNAs (siRNAs)–targeted separate sequences of lncRNA028466 were synthesized by Tianjin Sheweisi Biotechnology Company, including siRNA1, siRNA2 and siRNA3.
siRNA-1:
GGUUGAGAUUGGACGUUUCAUDTDT(sense) AUGAAACGUCCAAUCUCAACCDTDT(antisense)
siRNA-2:
GCCUAACCUUGUACCCUCUUUDTDT(sense) AAAGAGGGUACAAGGUUAGGCDTDT(antisense)
siRNA-3:
GGCCAGAUAAGCUGCAADTDT (sense)
UUGCAGCUCUUAUCUGGCCDTDG(antisense)
Naive CD4+T cells sorting, transfection and differentiation
Healthy female BALB/c mouse spleen was placed on a 70 μm nylon cell filter to prepare single-cell suspension. Briefly, an magnetic beads isolation kit (Miltenyi Biotech, Bergisch Gladbach, Germany) was used for negatively selecting naive CD4+T cells following the manufacturer’s instruction. The purification of naive CD4+T cells population (CD4+CD25-CD62LhiCD44low) was >90% . Subsequently, RPMI 1640 (Gibco, Grand Island, USA) with 2 % FBS was used for resuspending naive CD4+T cells, and then the cells was cultivated at 37 ℃, 5% CO2 in 1´106 cells / well of 48-well plate, then 100 uL pCDH-CMV and pCDH-028466 lentivirus or 20 nM siRNA and negative control siRNA were added in the presence of Lipofectamine 3000 (Thermo Fisher Scientific, CN.), total volume was 250μL / well. After 6 h, the transfected cells were removed into a 24-well plate. For Th1 and Th2 cells activation, as previous reported[38]. The cells were used to do later experiment after transfection 96 h.
Quantitative real-time PCR
Cultures were harvested after 96 h. Trizol reagent (Invitrogen) was used for isolating the total RNA. Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, CN.) was used to synthesize cDNA according to the manufacturer’s instruction. SYBR Green probes (DBI Bioscience) and Step One Plus TM Real-Time PCR system were used to analyze Th1 cytokines IFN-γ, IL-2, and Th2 cytokines IL-4, IL-10 expression. The gene relative exprerssion were calculated according to the 2-ΔΔCt method. Specific primer sequences were listed in Table 1.
Table 1. Sequences of primers used for qRT-PCR
Gene
|
primer(5′→3′)
|
lncRNA 028466
|
F:AGGCCCAGTCTCTCTTGTGA
R:GGGTCTGATGGGTCTCAT
|
IL-2
|
F:TGAGCAGGATGGAGAATTACAGG
R:GTCCAAGTTCATCTTCTAGGCAC
|
IFN-γ
|
F:CTCCCGTGGCTTCTAGTGC
R:GCCTTAGTTTGGACAGGATCTG
|
IL-4
|
F:ATCATCGGCATTTTGAACGAGG
R:TGCAGCTCCATGAGAACACTA
|
IL-10
|
F:GCCACGGCACAGTCATTGA
R:TGCTGATGGCCTGATTGTCTT
|
GAPDH
|
F:AGGTCGGTGTGAACGGATTTG
R:GGGGTCGTTGATGGCAACA
|
Flow cytometry analysis
We cultured the transfected cells under Th1 and Th2 polarizing conditions. Cell Stimulation Cocktail and Protein Transport Inhibitor (Invitrogen) were added into transfected cells in the last 6 h incubation. For cell surface staining, we first used 0.1 % BSA, 0.05 % sodium azide PBS buffer washed the collected cells. Then, the surface antibody APC-labeled anti-CD4 and PerCP-cy-5.5-labeled anti-CD3 (BD Biosciences) were used to stain the cells under the dark for 30 min at 4 ℃. Subsequently, 4 % paraformaldehyde was used to fix the cells under the room temperature for 8 min in dark, and 0.1 % BSA, 0.05 % sodium azide, and 0.1 % saponin (Sigma) PBS buffer was used to permeabilize the cells under the room temperature for 2 h in dark. After washing, PE-labeled anti-IFN-γ, PE-labeled anti-IL-2, PE-labeled anti-IL-4, PE-labeled anti-IL-10 (BD Biosciences) were respectively used to stained the cells under the dark for 30 min at 4 ℃. Stained cells were assayed with flow cytometry (BD Biosciences) and the program FlowJo version 10.0 (Tree Star Inc. USA) was used to analyze the data.
ELISA
Transfected cells were stimulated with Cell Stimulation Cocktail in the last 6 h incubation. Supernatants were collected after 96 h and specific ELISA kit (BD Biosciences, San Jose, CA, USA) was used to detect the cytokines levels following the manufacturer’s protocol.
Statistical analysis
Using SPSS 17.0 statistical software and GraphPad Prism6.0 software to analyze the experimental results, the measurement data represented as mean ± standard error, according to comparison between the two groups using two-tailed t test. The test level was α= 0.05.