Identification and validation of the first EST-SSR markers based on transcriptome of Anopheles darlingi, the primary transmitter of malaria in Brazil

doi:10.21203/rs.3.rs-2459591/v1

Download PDF

Short Report

Identification and validation of the first EST-SSR markers based on transcriptome of Anopheles darlingi, the primary transmitter of malaria in Brazil

https://doi.org/10.21203/rs.3.rs-2459591/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Jun, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background Anopheles darlingi is a monotypic species in terms of its morphological, genetic, and behavioral aspects and is the primary transmitter of human malaria (99%) in Brazil, especially in the Brazilian Amazon. In this pioneering study, 15 expressed sequence tag (EST)-simple sequence repeat (SSR) markers were obtained and characterized in samples from the municipality of São Gabriel da Cachoeira, Amazonas state, Brazil, with polymorphisms that can be used for further genetic research.

Methods and Results The specimens (from egg to larval stage) collected were bred in the insectary at INPA (National Institute for Amazonian Research). The SSR repeats within the contigs of the A. darlingi EST banks were confirmed on the Vector Base site. DNA was extracted and amplified using polymerase chain reaction and then genotyped. Fifteen polymorphic SSR loci were identified and characterized. The number of alleles totaled 76, and ranged from 2 to 9. The observed heterozygosity varied between 0.026 and 0.769, the expected heterozygosity between 0.025 and 0.776, and the mean polymorphism information content was 0.468. Eight loci showed Hardy-Weinberg equilibrium (HWE) after Bonferroni correction (P: (5%) ≤ 0.0005). No linkage disequilibrium was found among the loci.

Conclusions The polymorphic SSRs of the loci have been shown to be efficient for investigation of the variability and genetic population structure of A. darlingi.

SSRs

Transcriptome

Genetic variability

Malaria.

Anopheles (Nyssorhynchus) darlingi Root, 1926 is the most endophagic and anthropophilic malaria vector in the Neotropical region [1, 2], and its contact with humans is due to its anthropogenic actions, which increases the risk of disease transmission [2]. There were 140,974 cases of malaria registered in Brazil in 2020 and, worldwide, in the same year, 241 million cases of this disease, with 140,974 deaths [3].

Given these indices, research on genetic structures has been carried out in several vector species [4, 5] using previously isolated and characterized SSR microsatellite markers. A total of 11 loci have been isolated and characterized in 323 Anopheles marajoara from northern Brazil [6]; Twenty five loci in 24 to 36 Anopheles albitarsis sensu lato from Puraquequara, Manaus, Amazonas state [7]; Twelve loci in 20 to 25 Anopheles triannulatus s. l. from Manaus [8]; Ten loci in 37 to 48 Anopheles nuneztovari s. l from Manaus and Nova Mazagão, Amapá state [9]; Eight loci in 253 Anopheles darlingi from the states of Amapá, Pará and Mato Grosso [10]; Seven loci in 377 A. darlingi from the states of Acre, Rondônia and Amazonas [11]; Twenty four loci in 21 to 32 A. darlingi from Coari, Amazonas state [12]; ten loci in 440 A. darlingi from Rondônia (found along the Madeira River) [1].

Isolations and characterizations from A. darlingi Express Sequence Tags (EST) banks are also being developed (Rafael, personal communication; [13]), and are single-pass sequences produced from cDNA present in expressed and more conserved regions of the genome.

In order to provide the first DNA microsatellite markers of EST regions for the study of variability, and the evolution and population structure of A. darlingi, the present study identified and characterized markers for this species using the contigs of this mosquito, which were grouped in clusters.

The ESTs of A. darlingi, containing 568 UniGenes, were obtained from a library of adults and larvae of A. darlingi grouped in clusters (Rafael, personal communication; [13]). By means of the BLASTn tool, this EST bank was used to identify, quantify and locate the repeats motifs of the SSRs that flank exon regions from dinucleotide to hexanucleotide repeat motifs within the contigs. Among the repeat motifs, scores were established for the homology or protein similarity of the EST contigs that contain SSRs.

Pairs of primers, which flanked the repeat motifs of each contig sequence, were designed using the WEBSAT program [14]. Stringent criteria were adopted, which were the conditions that interfere with the association of nucleic acid strands, primer size (18 to 24 bp); annealing temperature (50 ºC to 65 ºC) with 3 ºC difference (forward and reverse primers).

Adult A. darlingi females were captured on the BR 307 highway, at highway marker 20, in São Gabriel da Cachoeira (SGC), Amazonas state, Brazil (00º 07' 48" S, 67º 05' 20" W), which is an area without insecticide pressure. The collection of A. darlingi was carried out under approval from the Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) (license number 32941) and the Sistema de Autorização e Informação em Biodiversidade (SISBIO), Brazil (permanent license number 32941). Samples were packed in plastic cups with thin mesh and transported to the insectarium at INPA for taxonomic identification [15]. After oviposition, the eggs were kept in plastic cups until hatching. The larvae were fed until the 4th larval stage, then individually packed in microtubes in a freezer at -80°C.

The genomic DNA of A. darlingi from SGC was extracted [16] from each larva of the 4th stage larvae (N = 40), digested in lysis buffer {Tris-HCl [50 mM]; EDTA [25 mM]; SDS [0.05%]; NaCl [25 mM] and sterilized Milli-Q water} at pH 8.0, then incubated (65 ºC/1 h with RNAse 10 mg/mL) and centrifuged (14,000 rpm/30 s with potassium acetate 3M, pH 7.2/10 min). The DNA pellet was eluted in TE 10X (Tris 10 mM, EDTA 1 mM) and preserved at -20 ºC. Electrophoresis (0.8% agarose) was performed and visualization was via a photo-documentation system (Alpha Imager MINI).

The microsatellite DNA reaction was prepared for amplification in a mixture of 1 µL of 10X buffer (200 mM Tris-HCl, pH 8.4 and 500 mM KCl, without MgCl₂); 2 µL dNTP at 1 mM; 0.2 µL Taq DNA polymerase [5 u/µL] (Promega); 0.3 µL of magnesium chloride (MgCl₂) at 50 mM; 0.4 µL of primer M13F (FAM, HEX or NED); 0.4 µL forward primer at 4 µM; 0.8 µL reverse primer at 4 µM; 1 µL genomic DNA at 10 ng/µL and ultrapure water (Milli-Q).

The PCR was performed in the following 4 steps: denaturation (68 ºC/2 min; 92 ºC/30 s); 30 cycles (92 ºC/30 s, each annealing temperature of each SSR loci was 68 ºC/35 s); addition of fluorescence M13F tail (FAM, HEX or NED) with 20 cycles (92 ºC/20 s, 53 ºC/30 s and 72 ºC/30 s); final extension (72 ºC/15 min and 68 ºC/15 min). DNA amplification was verified in agarose gel 1.5%, electrophoresis at 100 v, 170 mA, 140 W, 90 min, stained with GelRed (Biotium) and was visualized using an UV transilluminator.

The genotyping of the PCR products [1 µL PCR product + M13f Label primer (FAM, HEX, NED) + 7 µL (Tween 20 to 0.1%) + 1 µL ET-550 ROX (GE Healthcare) (1:10)] was performed in five multiplex systems, developed and used to optimize this step (Table 2). These were transferred to an automatic DNA Analyzer (ABI PRISM 3130xL, ThermoFisher) for sequencing and were visualized using GENEMARKER software (v2.6.4) (Soft Genetics, LLC).

The polymorphism information content (PIC) was estimated using MSTOOLS v.3 [17] and the Hardy-Weinberg equilibrium (HWE), and expected (H_E) and observed (H_O) heterozygosity were analyzed in GenAlEx v.6.5 [18]. The MICROCHECKER 2.2.3 [19] analysis showed the null alleles, dropouts, and stutters. The FSTAT v2. 9.3.2 [20] program provided descriptive statistics, such as the inbreeding index (F_IS) and linkage disequilibrium (D_L).

A total of 59 contigs with A. darlingi transcriptome SSRs were identified (34 dinucleotides, 23 trinucleotides, 1 tetranucleotide and 1 hexanucleotide). Thirty-seven pairs of primers were designed. The type of repetition of most of the SSRs was perfect simple and the most frequent repeat motif was dinucleotide (AC/AG).

The characterization of 40 A. darlingi in the 37 pairs of primers generated the amplification of 28 SSR loci of which 15 were polymorphic and amplified at 56 ºC to 65 ºC with size ranged from 115 to 368 bp (Table 1).

In all the 15 polymorphic SSR loci the dinucleotide repeat motif (AC/AG) was the most frequent. This motif was also found in A. darlingi from Coari, Amazonas state (Brazil) [12], in A. gambiae from Africa [21], in A. culicifacies from India [22], and in A. triannulatus from Manaus, Amazonas state, Brazil) [8]. However, in A. darlingi from Capanema, Pará state (Brazil) [10], the repeat motif that stood out was the (TC/GA). This indicates that dinucleotide is the most frequent type of SSR, and this is irrespective of the species.

The 15 SSR loci had a total of 76 alleles, ranging from 2 to 9, with a mean of 5.0 alleles per locus; variation of observed heterozygosity was 0.026–0.769 with a mean H_O of 0.402 and an expected H_E of 0.025–0.776, with a mean H_E of 0.509 (Table 2).

Considering the genetic variability, the allelic frequency found in A. marajoara (11 to 52) [11], in A. albitarsis (2 to 10) [7], in A. triannulatus (3 to 10) [8], in A. stephensi (3 to 16) [4], in A. darlingi (7 to 44) [10], (4 to 11) [12] and from 2 to 9 (Table 2) in this study, indicated that SSRs are efficient for the investigation of the genetic structure of populations due to their high polymorphism.

The variations of observed (H_O = 0.026–0.769) and expected heterozygosity (H_E = 0.025–0.776) found in this study were similar (Table 2) when compared to A. culicifacies (H_O = 0.045–0.607 and H_E = 0.170–0.841) [22], A. gambiae (H_O = 0.216–0.894) [21], and A. nuneztovari (H_O = 0.354–0.866 and H_E = 0.613–0.932) [9]. Comparing the heterozygosity of A. darlingi in this study with those of other populations of the same species, such as those from Capanema, in the Pará state (H_O = 0.368–0.769 and H_E = 0.785–0.987) [10] and Coari, Amazonas state (H_O = 0.037–0.833 and H_E = 0.177–0.871) [12], higher values are noted.

Based on the values of the PIC scale [23], eight highly informative loci (Adar4. Adar11, Adar13, Adar16, Adar24, Adar30, Adar34, Adar36) and five moderately informative loci (Adar1, Adar3, Adar6, Adar19, Adar32) were observed. Thus, new loci with this performance are made available for future studies of the species.

Eight loci presented significant HWE after Bonferroni correction (P: (5%) ≤ 0.0005) [24]. The HWE deviation present in the other loci may have been caused by the presence of null alleles, the bottleneck effect, or due to mating between related individuals. No linkage disequilibrium was found among the loci (Table 2).

HWE was found in all SSR loci of A. moucheti with no null alleles in 3 loci of A. maculipennis, which presented some null alleles due to the deficiency in heterozygotes [13], and in 2 loci of A. triannulatus, with the presence of null alleles due to excess homozygotes [8]. On the other hand, HWE was found in 11 loci of A. albitarsis [7], in 6 loci of A. nuneztovari [9], in 10 loci of A. darlingi [12] and in 7 short tandem repeat (STR) loci of A. darlingi [5], which is similar to what was found in this study. This is due to the presence of null alleles and/or a bottleneck effect.

In addition, ESTs such as cuticular protein 23 RR-1 family, troponin C, ribosomal genes, and myosin light chain 2 from a cDNA library of A. darlingi (Rafael, personal communication; [13]), were submitted to the basic local alignment search tool (BLAST) against A. gambiae, the primary malaria vector in Africa, via an in silico hybridization method. These gene sequences showed regions of similarity in the 2L, 2R, 3L and X chromosome arms between both species, as well as with ESTs from other insects such as Aedes aegypti, Drosophila melanogaster and Culex spp (L. Bridi, personal communication). Furthermore, troponin (L. Bridi, personal communication) and actin [25] were hybridized as probes via a fluorescent in situ hybridization method in the polytene chromosomes of A. darlingi, which showed markers located in the arm 2R, section 14B, and in the arm 2L, section 23, respectively. These results provide a suitable basis for establishing chromosomal and evolutionary genomics homologies among major malaria vectors.

The present work provides 15 new microsatellite markers for A. darlingi, totaling 64 SSRs, when considering the studies that developed and characterized SSR loci, which are the first EST-SSR markers.

Considering the great capacity of A. darlingi for the transmission of malaria and its resistance to synthetic insecticide, the EST-SSR markers characterized are potential tools in future populational studies of this mosquito and actions for its control, especially in the Amazon.

The 15 microsatellite loci of the EST regions characterized in A. darlingi from São Gabriel da Cachoeira, identified in contigs with SSRs of the transcriptome of this mosquito, were polymorphic and can have potential for the population study of this species.

Funding: The authors would like to thank Financiadora de Estudos e Projetos (FINEP) (CTPETRO Amazon network – Process No. 01.08.0282.00) for M.S.R.; Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (Malaria Network–Process No. 555665/2009-7) for W.P.T.; CNPq/FAPEAM/INCT-ADAPTAII/INPA, Process No. 465540/2014-7 for A.L.V; Governo do Estado do Amazonas, Secretaria de Estado de Desenvolvimento Econômico, Ciência, Tecnologia e Inovação (SEDECTI), Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM) - Institutional program for the support of postgraduate studies Stricto Sensu (FAPEAM-POSGRAD 2020/2021) (T.O. 159/2020 and 186/2021 for JSB/PPG-GCBEv/INPA). The PPG MBT at Universidade Estadual do Amazonas (UEA), the PPG GCBEv at Instituto Nacional de Pesquisas da Amazônia (INPA), and the Laboratório Temático de Biologia Molecular (LTBM) at INPA, and Laboratório de Vetores da Malária e Dengue/INPA for logistical support and maintenance teams in the collection points of the A. darlingi, located on São Gabriel da Cachoeira municipality, Amazonas State, Brazil.

Conflicts of interest: The authors declare that they have no conflicts of interest. This manuscript contains original data and has not been published and is not being considered for publishing in any other journal.

Author contributions: MSR and JSB conceived the study; MSR collected the specimens; ATS and GMGM conducted the experiments and analyzed the data; ATS, JSB, GMGM and MSR wrote the manuscript. All authors read and approved the final version.

Ethics approval: The collection and transport of A. darlingi was carried out under approval from the Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) (license number 32941) and the genetic access from the Sistema de Autorização e Informação em Biodiversidade (SISBIO), Brazil (permanent license number 32941).

Angêlla AF, Salgueiro P, Gil LHS et al (2014) Seasonal genetic partitioning in the neotropical malaria vector, Anopheles darlingi. Malar J 13:1–10. https://doi.org/10.1186/1475-2875-13-203
Tadei WP, dos Santos JMM, Rodrigues IB et al (2012) Malária em São gabriel da Cachoeira, AM: fatores entomológicos, dinâmica de transmissão e controle. Desvendando as Fronteiras do Conhecimento na Região Amazônica do Alto Rio Negro, pgs 287–310
World Health Organization (WHO) (2022) World malaria report 2022. World Health Organization
Sharma R, Sharma A, Kumar A et al (2016) Population genetic structure of urban malaria vector Anopheles stephensi in India. Infect Genet Evol 39:35–44. https://doi.org/10.1016/j.meegid.2016.01.003
Rosero CY, Jaramillo GI, Gonzalez R, Cardenas H (2017) Genetic Differentiation of Colombian Populations of Anopheles darlingi Root (Diptera: Culicidae). Neotrop Entomol 46:487–498. https://doi.org/10.1007/s13744-017-0488-0
Li C, Wilkerson RC, Fonseca DM (2005) Isolation of polymorphic microsatellite markers from the malaria vetor Anopheles marajoara (Diptera: Culicidae). Mol Ecol Notes 5:65–67
Guimarães-Marques GM, Batista JS, Guimarães HM et al (2012) Isolation and characterization of 25 microsatellite DNA loci for Anopheles albitarsis sensu lato and inter-specific amplification in 5 congeneric species. Genet Mol Res 11:4198–4203. https://doi.org/10.4238/2012.December.6.3
Cruz PF, Batista JS, Formiga KM et al (2013) Isolation and characterization of polymorphic DNA microsatellite loci for Anopheles triannulatus sensu lato (Diptera: Culicidae) and cross-amplification in congeneric species. Genet Mol Res. https://doi.org/10.4238/2013.March.13.11. 12:
Cunha-Machado AS, Scarpassa VM (2014) New microsatellite markers for the neotropical malaria vector Anopheles nuneztovari sensu lato. Genet Mol Res 13:8856–8861. https://doi.org/10.4238/2014.October.27.26
Conn J, Bollback J, Onyabe D et al (2001) Isolation of polymorphic microsatellite markers from the malaria vector Anopheles darlingi. Mol Ecol Notes 1:223–225
Scarpassa VM, Conn JE (2007) Population genetic structure of the major malaria vector Anopheles darlingi (Diptera: Culicidae) from the Brazilian Amazon, using microsatellite markers. Mem Inst Oswaldo Cruz 102:319–327. https://doi.org/10.1590/s0074-02762007005000045
Lima GN, Batista JS, Formiga KM et al (2010) New 24 polymorphic DNA microsatellite loci for the major malaria vector Anopheles darlingi and transpecies amplification with another anophelines. Conserv Genet Resour 2:205–209. https://doi.org/10.1007/s12686-010-9237-y
de Azevedo-Junior GM (2011) Anotação do transcriptoma parcial de Anopheles (Nyssorhynchus) darlingi Root, 1926. Instituto Nacional De Pesquisas da Amazônia – INPA
Martins WS, Lucas DCS, Neves KFS, Bertioli DJ (2009) WebSat - A Web Software for MicroSatellite marker development. Bioinformation 3:282–283. https://doi.org/10.6026/97320630003282
Forattini OP (1962) Entomologia médica, vol. 1. Universidade de São Paulo, São Paulo 185–302
Wilkerson R, Parsons T, Klein T et al (1995) Diagnosis by Random Amplified Polymorphic DNA Polymerase Chain Reaction of four cryptic species related to Anopheles (Nyssorhynchus) albitarsis (Diptera: Culicidae) from Paraguay, Argentina and Brazil. J Med Entomol 32(5):697–704
Park S (2001) MSTOOLS (Excel spreadsheet toolkit for data conversion) Trinity College, Dublin 2, Ireland
Peakall R, Smouse PE (2006) genalex 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295. https://doi.org/10.1111/j.1471-8286.2005.01155.x
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535–538. https://doi.org/10.1111/j.1471-8286.2004.00684.x
Goudet J (1995) FSTAT (version 1.2): a computer program to calculate F-statistics. J Hered 86(6):485–486. https://doi.org/10.1093/oxfordjournals. jhered.a111627
Lanzaro GC, Zheng L, Toure YT et al (1995) Microsatellite DNA and isozyme variability in a West African population of Anopheles gambiae. Insect Mol Biol 4:105–112
Sunil S, Raghavendra K, Singh OP et al (2004) Isolation and characterization of microsatellite markers from malaria vector, Anopheles culicifacies. Mol Ecol Notes 4:440–442. https://doi.org/10.1111/j.1471-8286.2004.00698.x
Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32:314
Rice WR (1989) Analyzing Tables of Statistical Tests. Evolution 43:223. https://doi.org/10.2307/2409177
Bridi LC, Sharakhova MV, Sharakhov IV et al (2013) Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi. Med Vet Entomol 27:118–121. https://doi.org/10.1111/j.1365-2915.2012.01019.x

Table 1. Putative functions and characterization of 15 polymorphic EST-SSR loci from Anopheles darlingi from São Gabriel da Cachoeira, Amazonas state, Brazil.

VectorBase Accession No.	GenBank Accession No.	Locus	Primer sequence (5'-3')	Repeat motif	Dye	Ta (°C)	Size range (bp)	Putative function, accession code
ADAC008921	XP_049546846.1	Adar1	F: [M13] CTGAAGTCCATCGTTACCAGC	(TC)₈	FAM	60	175 - 181	ATP synthase subunit alpha [Anopheles darlingi] ADAC008921-RA
			R: CAATTCTCAGCCTCTCTCACG
ADAC003454	XP_049548517.1	Adar3	F: [M13] CGCTTCGTCGTCTTCTTCTAC	(CTA)₆	FAM	58	222 - 228	unspecified product
			R: CACCTGTGTTCAGTGCTCCTT
ADAC006317	XP_049547296.1	Adar4	F: [M13] CGACGAATGATGTGGATGTC	(AC)₆	FAM	60	152 - 176	Troponin C [Anopheles darlingi] ADAC006317-RA
			R: TGGCTCTAACAAAGATCGGC
ADAC008921	XP_049547296.1	Adar6	F: [M13] CTGAAGTCCATCGTTACCAGC	(TC)₈	FAM	60	173 - 181	ATP synthase subunit alpha [Anopheles darlingi] ADAC006317-RA
			R: CAATTCTCAGCCTCTCTCACG
ADAC001844	XM_049691057.1	Adar11	F: [M13] TAAGGAAGACTCAGGGGCAAC	(CAG)₇	FAM	58	115 - 150	Stoned-A [Anopheles darlingi] ADAC001844-RA
			R: CTTCTCATCCACGTCAGTGCT
ADAC007453	XP_049536131.1	Adar13	F: [M13] ATCGGTCGAGTCCGGTTC	(ACG)₆	HEX	56	115 - 181	unspecified product
			R: CGGTAGCCAGAAGCAGATGTA
ADAC007453	XP_049536131.1	Adar16	F: [M13] AGTGGTAGCCAAGGAGAAGGA	(TCA)₄	HEX	60	258 - 267	unspecified product
			R: TATCGTAAATGGGCTGAGGG
ADAC001738	XP_049548491.1	Adar19	F: [M13] TCGGAGACGATCTGGATACTG	(CAG)₆	HEX	61	359 - 368	Cuticular protein 23 RR-1 family [Anopheles darlingi] ADAC001738
			R: CGCTACGTGGACATTAGAGGA
ADAC007403	XP_049537137.1	Adar21	F: [M13] GACAGTACCTGATGCCGAACA	(GAG)₅	HEX	64	337 - 340	Ribosomal protein L32 [Anopheles darlingi] ADAC007403-RA
			R: CTTGACACCAATCGCTGATG
ADAC000938	XP_049546089.1	Adar24	F: [M13] GAGCACCGACTGAAACTGTGA	(CTA)₅	HEX	65	320 - 354	Ubiquitin-related modifier 1 [Anopheles darlingi] ADAC000938-RA
			R: CGAGCGTCTGATAGATGGAAG
ADAC008019	XP_049533270.1	Adar30	F: [M13] CCCTACCATTGCTGGACG	(CAC)₅	NED	60	186 - 210	unspecified product
			R: AGTCGATACGGAAGGAAGCAC
ADAC003721	XP_049546781.1	Adar31	F: [M13] ACTGCTCGGTGGTAAAGTGC	(AAG)₅	NED	60	143 - 148	40S ribosomal protein S30 [Anopheles darlingi] ADAC003721-RA
			R: GACGGTTGTACTGGATGCGT
ADAC008233	XP_049532280.1	Adar32	F: [M13] TTTGCTCCTTCTCCTACCTCC	(AC)₆	NED	60	334 - 338	Actin [Anopheles darlingi] ADAC008233-RA
			R: GTTCGTGATGATACCGTGCTC
ADAC008233	XP_049532280.1	Adar34	F: [M13] GTGGATCTCGAAGCACGAGTA	(AAC)₄	NED	60	271 - 288	Actin [Anopheles darlingi] ADAC008233-RA
			R: GACAGACACCACCACAAGAGC
ADAC000311	XP_049531897.1	Adar36	F: [M13] ACACCTCTTGTGGAAGTGGG	(AAC)₃ tga (AAC)₇ ac (AAC)₂ g (AAC)₅	NED	60	185 - 200	Myosin light chain 2 [Anopheles darlingi] ADAC000311-RA
			R: CATCTCCGCACCTCTTTAGG

Ta: annealing temperature (°C).

Table 2. Parameters of genetic variability of each of the 15 expressed sequence tag-derived simple sequence repeats (EST-SSR) from Anopheles darlingi.

Multiplex Systems	Locus	H_O	H_E	N	Na	PIC	P-HWE	FIS (f)
1	Adar1	0.410	0.368	39	4	0.343	0.793	-0.102

2	Adar3	0.410	0.443	39	3	0.356	0.303	0.088

3	Adar4	0.667	0.776	39	9	0.750	0.040	0.154

4	Adar6	0.410	0.422	39	5	0.395	0.099	0.042

5	Adar11	0.769	0.688	39	7	0.654	0.929	-0.105

2	Adar13	0.564	0.700	39	7^a	0.667	0.069	0.206

1	Adar16	0.550	0.618	40	4	0.542	0.230	0.123

3	Adar19	0.325	0.417	40	4	0.357	0.008	0.233

4	Adar21	0.026	0.025	39	2	0.025	0.000^*	0.000

5	Adar24	0.385	0.713	39	8^a	0.668	0.000^*	0.471

2	Adar30	0.658	0.641	38	7	0.593	0.000^*	-0.014

4	Adar31	0.026	0.026	38	2	0.026	0.000^*	0.000

1	Adar32	0.162	0.444	37	3^a	0.400	0.000^*	0.643

3	Adar34	0.289	0.594	38	5^a	0.517	0.000^*	0.522

5	Adar36	0.385	0.763	39	6^a	0.726	0.000^*	0.505

Observed (H_O) and expected (H_E) heterozygosity, sample size (N), number of alleles (Na), Polymorphism Information Content (PIC); P-HWE* loci that did not show Hardy-Weinberg equilibrium after Bonferroni correction; FIS(f) = inbreeding index; *P: (5%) ≤ 0.0005 after Bonferroni correction.

Download PDF

Journal Publication

published 14 Jun, 2023

Read the published version in Molecular Biology Reports →

Editorial decision: Major Revisions Needed
06 Feb, 2023
Reviewers agreed at journal
12 Jan, 2023
Reviewers invited by journal
11 Jan, 2023
Editor assigned by journal
10 Jan, 2023
First submitted to journal
09 Jan, 2023

You are reading this latest preprint version

Identification and validation of the first EST-SSR markers based on transcriptome of Anopheles darlingi, the primary transmitter of malaria in Brazil

Status:

Journal Publication

Version 1

Abstract

Introduction

Material And Methods

Results And Discussion

Conclusion

Declarations

References

Tables

Status:

Journal Publication

Version 1